Description :
From Genome Similarity Track
Location :
Scaffold_144:20889- 24003
Sequence
3114 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCGTCCAAGGACAGCTACCCCTGCATCCAACATGAACATGTTGGATGATGATCGTGACAACTTTCACACCAC
GCGTGAAAGCTACTCCTATTTGAGTGACATCAAATGGAATGCGGTCGAACGACTGGGTTTGACAGTCGGCAAACATGCCGACTGTGCCATGCTGTCCGCA
CTGGACAGAGATGAGCAGCTTGCCGCCGTCGCCAAGTTCACACAACATGAACTTGACGAGTCACGGTAGAAAGTAACCTTGCTTCACCAGCAAGGTTCTC
AACAGAAAGAGCTGCTGAGAGAACAAAGTGCTCAACAGTTCGAACTAATAAGACAACAGCAGGCAGAAACTGCTGTTCCCGGGTCGACGCACGCGGGTCG
ACCCGAATCCTCGAAGATTGACATCTCCACGTACAGAGGAGTCGAAGAAGACTCCCTGTTGAAATGTTCGTCGAGTCAGACGATTCCATAAGGACTCGGA
ACATCGTTAATGAGCAAATGCAAGTCGCATTGGCTCAGTCGAACTTGGCAGGACGTTCCAAAACTTGGGCACTAAGTCTCAAGTTGCACGACCCATACGT
GTTTGGGTCGTTGGAGGTCTTCCAGGCCCGGCTCAGACAAACGTTTGAACCGCCACGGGCTGAGTTCAGGGCTTGATCAGAGCTCCTAAAGCTCAAGCAG
GATAAGCGTGATGTGCACGCTTACGCCCAACACATACGACTCCTTGCGAGTTGTATCACGGCCAACCCGTTCCATGAACACACGTTGATTATGGTGTTCA
TGCAGGGTCTTGTGGATGGTCTTGTCAAGATCCACCTGTTCCGCTTGTAACTGAATTCGCTAGAAGAAGCGATATCGGTTGCGGAACAGGAAGACTTTAG
CTTGAGACAGGCTCATGCTAGTTCGGGTTCATATCGTCCCCCAAGACGACAAAAGTCGGAGGTACAGGACCTATGGACCTCTGTTATACTGAGAGCGAGA
GACCTCGCTCTTCAAATAACAAGCGATTGCAGAGATGCAATCGCTGTCAGAAACTAGGACACTTTGCCTACGAGTGTAGTGCCCTACAACCAGTGTATCG
AAGCACTGAGTGAACCCATCGACCGTCCGCCAAGAAGGGCAACGGACGCGGGTCCAGTGTTGTTGCGATTTTGCAACAACGAAATGAAACGTCAAATAAC
GGTCAGGGTTAATAGGAGCGGAGCGCCCTACCGATCCAGCGACTTCAAGAGAATTCGCAAATATCTTGATGAAAATTACTCCAGACTCACAATCACTATG
TGTCTCTGCACTTGGTGATGTGGTACCCCTCCAACTTCAAGGTGACGACCTTGAAGTTGGAAGTGACAAGAGATGTAACTTCATGACCTAGAAGACTGTG
GGGCGTCGAACAACTTTGTTCATCGCCAGTCGCCAGAGGGTCGTTGGCTCAAGTTCGTTGAGCGCGACATCCCTCCAACATGGATGACGGTGCGCCTAGC
AACAGGCGCATCGATAACATTGATGAAACGTGTAGTGGGAATTGACTACACGCTGGAAGATTTGCAGTGCGATGATGATTTCATCGTACTGGATTTGGAT
GACAAGTTTTCTGTCATCATAGGCTTACATTGGCTCAGATCATACGAGCTAAGGGTCAGCTAGAAGCATCTAACCGTGAAGATGCCTGCCACTTGTTCAT
CATATGGCCATCTGGTGAACGTCTTGGATCGTCCACAAGCGTGTGGATGTACTTCGATTGAGTACGATGGTCTCACTTGTGGTACGGTCGTTACTACGAC
TGCACAAGGTCACAGTGAGACGACCAATCACACTGTGGAGGAAGCTGCCGGTGGCTGTGCGGGTGCACAGGTAGTGCCGAAGGTCCACCACTCGAACAAG
TCGAGTGGATCGGGACATGGGTGTATACCTAGCTGGCGACATCGAAGTATTAATAAACTGGTTGCCCACAAAGGGCAACACGATGATCTTAGATAGACCG
GAGAGTCGATCATAGAGGACCTGGATGTGGTAGCGCAGCCACAGCTAGAAGACGTCGAGAAAATGAGTCCCCACGTACTTGATAAACAAACCCCTCAATC
AGATACTGTTGAGGCAACAAGACCTCACCAACCTGATGGAATAGGTCCCCAGAAGCCTGTGTAAATAGGTTCCCAGGATGAAACCTAGATATTGAATGTC
TTGGTTAATGATGGGTCAAGTATAGGCGCTTATACACTTGATCTGATCGCGCCTCCGAAGTCAACTTCGGAGATCACTTAGCTACCTACGCTAGAACCAA
AACATTCTTGTGAGATCTGCTCAGTGGCAAGGTCAAATAGATCTACGTACTCGTCGCAGAGGACGAGTACGTGACCGATATTCGGCCGGCAGTAGTATTC
GCCGAGAACGAACGGGTTCTCAGCAGCTCATCGATGGACGAATGTGTCCTCAATGAGAAGACTCGGATTGAGCGATATACGTCTCAATCTTGTGAGTCAC
TTCAGCCAAATCCTTTGTATGAGGATTTGATCGAATCCAGAGATGTGTTCCCTGAATCCGTACCATGCGAGTTGCCTAAGGATAAAGGCACTCGACATGG
AATCGAGCTCAAACCGGGATCGACGTATTGTGTCATGAAGCAGTGGCTACTGCCTCGTCAACAAGTACTTGCGATTGACAAGTTCTTTGCCGATCGCTTT
GCAGCGAGCCATGTGAGGGAGTCAACCTCCCCACATAGCTCTCCGACCTTCTGTGTGCGCAAGGCCACAGGAGAATGGCGGATAGTGCATGCATTCAACA
AGATTAATGCTGCAACGGTACCGGAGCAGGCGCCGATACCGAGGAAGGACGTCATCATAGATGGTACGGCGAAGAGTACCATCTTTTCGTCCATGGATCT
GATGGATGGATTCTATCAGATCCATATGCATGAACGAGACGTCCCGTTCACAGCAGTAAGCACCCCCAGCAGTATACTCTGGAAATGGCTTGTTATGCCA
CAAGGGATTGGTAATCCCCCAGCCACATTCAACAAATGCGTCACAAATCTGTTGAGACCGGTGCGAGAATTTGCACCGAGCTACTTTGACGATGTCTTCG
TCCATATCCGGGAT