Description :
From Genome Similarity Track
Location :
Scaffold_75:20884- 22762
Transcript NameFunction/comments
g12272.t1XP_009535209.1 hypothetical protein PHYSODRAFT_361954 [Phytophthora sojae

Sequence
1878 bases(100 bases per row)
GCCCCCAGGCTCCTCTCCCAACGCCGCTTTAGGCGCCACCAGGTGGCCCCGTGTCCTCCTCCTCAGTCTGCACCCCCATCTGCTACTGCCCTTCCTACCG
AGCCCACCAAGACTACACCCAGCACCCAGAAGAAGCCCTACGTGCGCAAGAAACCCCTCGGATACAACCCCAACAAGGCGCGAGATGAACGCAAGCTGGA
GTTGGCTTACCTGCGCAATAAGGTGGTCGACATGGAGCTGGAGCTGCAGAAACTGCAGGAGATCAAGGGCAGCAAAGGAACCCTAGAAAGGGGACCCGAA
GCAAAGTCACCCACTTCAAATACCACCTTGGCTGCAAAGCACGACACTGACGATCGGGTGCCCCGCGTCTGGGAGAAAATGTGTGCTCGCCAGCTTGAGC
GGCGAGTGAATGCGGAGAGGGAGAACGCTCGCCTCAAAATGGTACTGGAGGGTCAGATCAAGATCGCTAAGAGTATGGAGCAGATCCTCAAAAAGCGCAC
GGTGCTGCGTTCCATGGAGTCCTGCGGCAGCAATAAGCGCACGAAACACACGAACCGTGTGCCTCGGCCGTCCGATCCTCGTGCTGACGCTAAAATCTTC
GAAGTGCTGCTTGCCGGCGTCGAGGCTTCATATCGGGAAGTTGACGCTGTGTTCGAAGCCAATGGTCTTGGCCGCACTGAGGCTCCGAAGAGCGACGCCC
AAATGCACGACGGCGTGAATGGCATGCACCTGGAGATCTTTGCCAACAAGATGCTGCCGTTTGGCATGCATGCTACGGGTGAGGCCGTGTGGCAACACTT
TAAGGGCACAGATATCCCCTACCGCTGGTATCACTCCAAATCCGCCGGCTCGATCGAGTCCACAGAGGACACGATGGTCGAGAGCTTCGGCATGGAGATG
TATGATGCCAACAGCAAGACGACAGCCGAATTCAACGTCAAACAGATCCTTCGTCGCTACGTCGAGGAAGATCGCGTCGTTGTGGTGTGGCGCTCGCATA
TTGAGCCGCTCGAGTTCTCCAACAAGCGGTTTGCTGGTATTCATTTCCAGGAAAAAGGCTACGTGGTCATTAAACCGCGTGCTCACAGCTACGATAGTGC
CGACGACGATGACTTCACCCTGGTACAGACGTGCTACATCATCACCCCCGATCTGTCCGATCAAACGCTGAACGACGATGCCAAAACTGGTGCTCTGACC
GAATTTGTGCTGAGCTCGACCGCTGCTAATATTTCCGCCAGTAACGAGATGATTGAAAACGTGCTGGTTGACCAGGCACTGCAGCAGCGAAAGCGTCGTG
GGTAAGACGTGGCACAGCCGATTCGAATTTGCGTTAGGCCTTTGTGTACGCATCTATTGCTTGAGTATTCATTTTTTCATTGCAGCTAGGACTGATTGTA
AGTTTCATTGAAGTCATTCTGATATACAACAGAAACGTGGTGTCCAGAATTCCAGAGTCAAATTTGCGATGCATTGGCTTGGACGAGGTGCCCGATCTAC
AGAAATCTATCACTGATTAGATCGCACAAGACCCGCTCCTTATCCGAAGATCCGAAGCTTTTAAACCAGTATACACAGCAGCTCACCGATCATACTGTTT
CTTGCCCAGTGCCAGCATCGGGATAAATGCTCTCTAGCAGTACATTTTGCTGCAATTGCAAGACATTCCGCAATTTTCTCCCAATCGAGTTCAGCACCAC
CCCTTCGACGTGAGCAAAGTCCAGCGGTAGGACTGATGCGGTGTCCACGCGCTTTACTTGCAGCTGGTAGCAACTCCGCACGACAGATGCATGCAGTGGG
TCTACAGGAGAAGGAGAAATGGTTGTCCAATGGTGGTCTTCAAACTGAAGCCCTCCCGTCGGAAGGAACCATGTCGTT