Description :
From Genome Similarity Track
Location :
scaffold_60:20881- 23756
Transcript NameFunction/comments
Pl_110804patched family protein

Sequence
2875 bases(100 bases per row)
GGAATAGGTTGGCCGTCAATACTGAGCTGCCCATGGTAACGCGTACCAGCTGCGTATGTACATAGCGGTCCAGCGGCCGCCGTCGAAAATATGCTGAACA
ACGACATGAACGACACCTGAGGGAGCGATAGCACTTGGCTCGCATCACCTAGACATGATGACGCTGCTGAAGCGCGCTCAAGAACGTACTCGGCACTACT
CTCTTCTGGTAGAAGAGGTAAATACGAGTAGTCGTTCGTAGGGTCAATGCGGCAGCACTCACTGTCCGGATTGATAAATCCCCAGAAATCATCCAGCCAT
GAGCCAACAACAGCACCATTTTTGAAGAAAGTGACGTTGCTTTCTCCATCGGTTACCAGTGCACTAAGGATGTTTGGAATCGATAAGTTGGCACAGATAT
CCTTCGAAGAGCACAACTTGCTTTGAGCCTTAGCATCATTCGCGAGGTCATTAAAGCTGTCTGGGTTGCTGCCGTAACCAGCTTCAACCACGAAATAGAC
AGGGAACTCCTTCGTCGACATATCATTATCGTCAATTGCACGGTAGTAAGAGTGCAGGTACGAATCAGTTGAGATGAAAGAGGTCGGTGAAAGACCTCGG
TCCATGGCTTCTATCGATACGATCGCCACCAGCGTGCACGCAGCAAAAACAAGGAGTACAAGCACCTTTGAGACTTTCTTCAACAGGACGTGCACGTAGC
CAGTAACAAAACGATACATCAAATTCAGGTCAGGCATCGAGTAGGAACTCCCCGGAAATGACGAGTTCTCGGTTGCAGTAGTGTTTTCATCTTCAGATAG
ACGAGGGCGACGAGCAAATGAAGCGCGCTTACAGCAGATCACGTCGTATGTACCGCTCAACTCACGACGCTTGTCAAGCGCCACAATGGCCAGGAACAAG
GTCATCTGTAAAGTGAAACTGGATGCAAGACCTAATACCAACGAGCCAGCAAGCCATTGCGCAGCTGGTATAGCCGAGTATGTAGCAAAAGCAACAATAC
AGCATTCGCATGTGACCGTCACGATCATGCTGGGACCAATGTGACCCGTAGCTTCACACAGCAGCACGCAAGTAATTTCATGGATACCGAAGTCGTTATC
TTCCAGGCCAACAAACAGCGACCGTTGTTCCATTTTCAATTCCTCCTGTTTCAGGTCAACGGCATGCAGAATCAAGAAGATGTTCCCCGTTCCGATTGCG
AGCATCAACAACGGCAGCACCACGAGAGTTACAATTTGAAGCTTCACACCAATCCACGCAAAGATACCCAAAGTACCGCCTACGGCCATTAGAATGCAAG
CAACGCCCATAAAGCCAACGCCAATCTTCGACGAATGAAAGAAACGATGATCCACCTTCCAGTGATTCAGGCCGATGACCACGTAGACGAACATAAAGAT
AAAGCCAGCAATTCCCGCCTTGAATACAATATCCAAGTTCGAACCAGCCGCAAACTCGTCGTCTTCAGAGATCTCAGCAGCATAGTAAATATCGTACAAC
ACATTGTTGTCCGCTTCTTTCTTCATTCTCGCAATGTAGGCGCGCTCCCAAGAGATAGCATCTGAATTTTTTTCTGCGTCCTGATGGTTAGTCACTACAG
CAGAAGAAAATAACGCTGTTGCCAATTCCAGGTACATGCTAGCGTCCACCGCATTACCATCCGCAGTAAAACCGCCCAGGTACTTCTCCATCTCAGTCAT
CGGCACACCAAAGGATGACACACAGGGGCAATCTATCATGCTGGCTGGAAGCGAAGTACCTGTAGCGTTCAACTGCACTTGTAGCTCGCCGCATGTAGCA
ACATCCGCTCGCTCCGGAGCATTTGCACAGTTGTTTAGGTGCTTATCTACCAGGCCATACGTCTCGTACATCTCGAAGTGGTCCATACTGTTCTGAAAGT
ACTGCGTAACAGCATTCACTTGGCAGGGCGAGTTTGAAGCATCTTTAACGCAGATATCACTCAGCGAAGTGTTGTTCGACGTGACTTCGTTTGCAACAAT
TTGCTGTAAACGAATCGCCTCCTTGATATAGGCCGATCTGGTTACAGCGCCACCATCCTTCGCAACAAGCACCAATCGTTCAACCCTATCCATTGGCCCA
AGCATCTTGCCAAAGCGAGCTTGCTCCTGGAAAACTGTGCTGCCCTTGGGTACCCATAGCTTCATTGAGTCCGTTTCCACCTCGAGACGAGCCAACCCAC
TCGAGCAGCAAACCACAAGCATCAACGAGAGAAGAATAATGTAGAGTGGGTGATTCCCCATTGCCACAAAGTCTCCCCACCGCTTTAGATGTTGCGTTAG
TCGATCATCCCAGCGCCCGATACCTTTCAACTGATCCAGATTTACTAATGACAGCATTCTAGACCCCATGGGTCCATTGACAGGATCATCCAACACAGAT
AGACGTTTCTTTTTGCTGTATCGCGTGGAGTACGCAAACCCAAGCGCCAATGCAGAGGCCGCAATGAATGCGAGCACAGCTAGGACGTAGTTCAGTACCG
CAAAACTGCTTCCTTCAGCACGGGATGATAAATCCGCCAACAGAGATTTAATTTTGCTTGAAGCAATGGCATTGCTGTTGACTGTGCTGTCCATAGTGAC
AGCCCTCAAATCACTAGATACCGATGAACTGCTTGTACTGTAGCAGGCTGACTCGTACGAACGATTATTATCAGCACTCGCTGCACACAGCGAGCCACAT
GTATCAACACACGATTCAAGCCGCGTATCCATCGGAGCGAAGCAACCAGTCGTATTGACACTGTCACAGGCACAAATCTTCTCCTTCTGTTCCGCTGCAG
ACAGTTGCTCCATCGTTGCGAAGTTCACCTGCGATGGTGATCCCACACCATCAAAGCTGTAAGCACCTAGATATT