Description :
From Genome Similarity Track
Location :
scaffold_54:20880- 32450
Transcript NameFunction/comments
Pl_110986hypothetical protein PHYSODRAFT_510279
Pl_110987hypothetical protein PHYSODRAFT_510256
Pl_110988hypothetical protein PHYSODRAFT_509429
Pl_110989hypothetical protein PHYSODRAFT_505033

Sequence
11570 bases(100 bases per row)
AGCTCTTCTTTCCGTTTAAACAGCGCAGGCTCAAGCTTTCGTGCAGGGGCAGGCGTACCCGTGTCGTCTTCAGCTCTACGTAGCCATGCCAGCTTCTTAA
TGATGGATATTGATGCAGCCAGACAGTCGGCGGACGCCCATTCTAGAGCGTTGAGCTTTAATGAAGATGATACAATGTCTGATGGTGGCAGATTGACCAG
GAACATGCTGGGAGATTCGACTTCGGGTAGAAGCAGCGGCGCTGAGAGATACAGAAGAGCCTGTACGTTGAAGAGAAGTGTGTGGAAGTAGTTGTCTGAT
TTTTGGTTTTGTTTCTGATAATTTATTTAGCGTCGTTGGATTCGAGTCCGCCATTGCCGCCGGATAGTACCATTTCGGCGGAGGAAGTGATTCGAGAGAG
TATGGCAAGTGCACTGAGTTCGTCGTTGTATACGGACAAGGACGAATTTTTATTGCCACATCAACGACGGTCGAATGCTGTGGGTGGAAATTTGGCAGTT
AACGAACGAGACTCGCTGGCCATGTCAAGACACTCGCGGGATAGTTTAGCGTTCTCATTTTCGAGTCGTAGCACGTTTCGACGGAGCACGATATCGGAGC
AGATGCTGTATGAGACGGACTTGTTTGAGCCAGAGCGTGAATTGAGTGCACGAGAGTTGTCTGAGGTGCTGAGTGGATCGGATGAAGATATCAATAGTTA
CGAAGTCACCAGCATAAAGGAGGAAGAGGAGGATGTCAAACTCGAAAACGCCAAGTCTCGATGGGCACAGCATGTCAAACTCAAGGCACGGAGCTTCCTC
TACTCCACGGTAGCGGGCAACAAAAACGGATCTTCTTCTGCTAGTAATGACGCTGTGCCTTCGGCTCCAACATCGGCAGAAATATGGGCGAACAAACAAA
AGCAGATTCTTGCGCAGATGAGCAGTGGTAGTGGCTTTGGTGCGATGTCGGGTGCCTCATCAGCTGCATCGTCATCATCAACACACCACCACTCAATATT
GCCTCCATTTGGACAAGCGTCTAATGGTGGTGCTAAGTTTCAGAAGTGGAATCGATGGATGCATGACCAGTATCAGCACAACTTCGGTAAGGTAATGCAG
CGCGCCTTCAAAGATGAGGTTTTGCAGCGACAGCGACAGCAATTTGCGTTCCCAGCTCATCAACCGACTCCAGACCCGACGACACTTATTTCCATTGAAG
AAGTTATTAGCAACCCGCGTATGATGCGCTATTACGCTGCGTGGCTCCCTGATCCAGCAGATCAGAGTAAATTGTTCTTCCTCTGTTCATTTGAGGAGTA
CCGGCAGTTTTGGTGTACTTTGCGTGCTAACTATCAGAAGAAGCCTTTTGCGAAGGATGATGTACTCATGTTACGCACGTACGGCGTCAAGATTGCAATG
AAGTACCTGGCAAAAAACGCGCAATTTCCAATTAATGGTACAGCCGATACAGAAGATGGAAGCGACGAACCTCCCATTGTGGACTCCAATAAGCTACGCT
CCATTAAGCGCGATCTGGCGGCGGGGGGCGAAGACGCATTACGCACATTCGATGATGTTGCTGTGAAAGTGAAACGGGAGCTCATGTTTAAGTTTCCTGA
ATTTCGCAAAACAGAGCTCTACACTGAAATGCAGAAGACCGTGGAGCGCGAAGTCATTTGTCTCGAGGATATACTGATGAACCACCGATTTGCCAATTTC
TTCTGGATTTTCCTTTTCCCGCACAACTATCACCGCGAGATTGCTCTATGGCTGGACGTCGAATATGAGTTCAAACCAGCATTTCGCATCTATATGTCTT
TGCTGAAGTCTAGTGGGAGCTCTCGAACAGCTCCATCTAGCACGAGCATCAACCAGCGGCGTGAGCGGATAGAACAGGTTGCTTATCGTTGCAGGAGGTT
GCTCAAGTACATATCACAAAAATACTATGCTGGGGACACTGAAATGCAGACACTGCCACGCACGTTGGTGACGTCCTGTGCACGCCTTCAAGCTGAGCAA
GATGCCATTTTGACGAAGTTTAGTCTTATTCACTTGGAGTTATATCACCGGTTCTTAACGAGTCGTGCATACGCTGAATTTTCGCTGTATCCGAAACTTT
CACCTGAGGACGAGAAGGATTCTATTGACGATTCCATGCGACTCTCTGCGTTGCTTCTGAGCTACGGTTTGCGAGCTCATCATTGGGCTGGTGGTAGTTC
GGGTTCCTCATCGTCAACCGGGTCTTCATCATCTAGTTCACGTGATGCTGAAACCACAATGCCGAAAAAGAAGACCCTTGACTCGCTCCGCACTGCGCGG
AGTTTTGAAGCCATATCTGGCGTACTCACGTTCGAAGCTGTATCCGCGCCGTTGACAATTGAAGAAGCGGACGACACCGATGAAATTGGTAGTACTGTGT
TCGAAGACCCGATTGAACTGCAGGTAGTACAGCACCCGTTGCCACATGACCCGACACCTCACGTCGTGGATAAGTCAGTCGAGAATTTCCTCGTACCTTG
GAGTGCAGACCCCAGACACGTGGTGCTTACTGCACCATCCTGTCCTGCACCCTTGGCGTTCAATTTTCGCATGGGCGACAGCAGTGCTGGCGCATCGGCT
GCCGAACTGTTTGCAGCTTGTGTGGTTCTGTATAAACCAGCACCTCCACTGTCACGGCGCGCACTCGAAACATCGCGGATAGATTCTGCAAGTGGTTGTC
GATGGGTACCTTACGGAGTTTGTGTGTTGTCCAAGTTTCCGATGGTGGATCTACTTCGAGAGCGCCTTGCCGAAGCATATGAATTCATTCTAGAGCTCGA
ATCTATAGCAGCAGCAGCTACTGCTGCGAATGGTGACGTAAAAGGCGTTCTTCATGATGGTGGTCATGGCTTTCAGCTAGACAAGAAGGTTCTTGCCAAG
TTGACCCGTTCCGTCTCAAAGGAGCATATCTCGCAGTATCACCAGCCATCACCGCTGCCTGAGTCACCGCTACTCGAAGCCTCAGGTTTAACGCCAAAGG
CCACAGCTACCTTGCTTCTTGCTACACTGCCGCGGCTGGATCACTCCGTGCGTCTTTTATTTGACACGCTGGATGTCTCAACAGTCCTTCTTGTGTTTAC
AGCAGCGTTACTGGAAAACCGGATTCTGTTGGTGTCATCGTATCTATCGGTGCTCATGAAGGTCGGAGAGTCCTTGCGAGCGCTCATGCACCCTCTGTCC
TGGCCGCACGTGTATCTTCCAGTGCTTCCACGACGAATGTTGCAGTATCTCGAGTGCCCGACACCCTTCATCTTCGGGGCCGAGAAACAAGCGCTTGATG
ATGCCCAACGTCAACTCAGTGAGGAAGGTGGTGATGATCTTTTTGCAGGAACTGGTGAGGAGCTGCTGGTTGTGGACTTGGACAAGGGAGCTGTTTTGCG
TGGAGAAGTACCCTGCCCTCTTCCTGACAGTGTTCGATTTGATTTACGTGACGCACTGTACGAATGTCTCAAGCCGAACGTGAGCCGTAGTGACCATGTA
TTTGCACACCACTTCCCAAGCAAACCACTAGTGTTTCCAGAAGTTGCTGTTCGTGGTCTATTCCTCCGGGCTGTGAACAAGCTAATTGGTGACTTTGGCT
ACCACCGATACGTTTGGACGGACGAGTTTGCGCGCAAACGCACTGTTTTCTTCGATGAAGCGAGCTATCTTGCAGCCTCTACACCAGAGATGCGGGAGTT
CCGAACATTGTTTATCGCTACGCAAGCCTTCTCGGAGTTTATGGTCACACATCACGGCTTCGAGGAACAACCAGGTCAAATTAATGGCACTGCAGGTCCT
CCAAGATCATCAACTTCCACGGCTTCTACTTCGTCGTCGTCTACTGTATCATCGATGCCGCGAAAATAAGCTCGGCATGCTCTAAACATATTTGTGAAAA
TGAGCCGTAGTGTGTTATGCTTTCAGGTGAAGGAAGGGTAGAACATATATGTACGTGACGTTCACGGTTTGAGCTAAACCAACTTGATATTTACTGTCGA
TACGCGCAAGACTTCTTTATGCCTGTTATGTTGGTGTTGTGCTTTTAGCTAAGACGAAGCATGGATGAAAGCAGTGTGGTGACTGCCAGCAACCCAAAGA
CCGTCGCTGGTGCGTTGAAACGCGAAGACCATAGCTGTTTCGACTCCGTCGCACTCACTGGAGCAGTATGAACAACTTGTTGCTGGTGTTGACGGTGGTG
AGCCATTTCCTTGTCGATAATTGTGTAGAGAATAGCTGCTACGCGACGACCGCTGTGTTTGAGCATGGGTGCCTTCTTCCACTCACGCGTAACATGACCA
GCTACGAGGTCTTCTTGAAAGGTTTGACCCTGAAGCAGCACTGGGTGTTCACTTGCTGCCATCTCGGGCGTAGGCAGTAAAAGTTCTTCACCTCGCTCTA
CATACGGCATGAGCACATCTTCCGGTGGCTGCGTATTATTGGCAATCACATAGTCAATGGCATTCGCGCCAAGGTAAGTTGATAACACTTCAAGCGTCTT
CTCTAAGGTGTAGCCGTCAGTCTGGCCATTCTGGGTAGTCACATTGCTCACGTACACGGTAGCACCAGCGCTACGTGCAATAGCATCGCGAATGCCAGGG
ACCAATAGCGTAGCAATGATCGAAGTGTAGAAACCACCAGGACTCAGGATAATGATGTCAGCATCCTCGATTGCACGCACTGCAGGCTGAAAGGCTTCCA
CGTTCGGGTTCTCAAGGTACACGCGTTTGATCGGCGCTTTCTTGATCTTCTCCTTTTGATTTTCAGGTTTTGGGGGTGTTGGTGGTGGACTTCCACTAGT
GCTGTTTGTTGAGGAATCGGAACCTGAACGAGGTTCGTCATCTACGTCTGGTATGAAAGGACTACGTACATTGACTTCCGAGACAACTGTCGAGCCGTCA
GTAAGCTCAGCACACAGCTCAGTACTTTCCAGGGTGGCAGGAAGCACGGAACCGTGGATGTTGAGGATGTCAGCAATTGACGAAACAGCACGGTCAAAAC
CACCTTGCAGATCAGTCAATGCTGCCAGGAGCAGATTGCCCAAACTACATCCCTCCATAAAGTTCTCACGAAAGCGATAGTTCATCAGCTTGCTCAAGAG
TTCATCTACGAATGAGTCTACCGTTAGTATACACGTACAACAACGTTCATCAGATAGAAAATACGAACCGGAGTCGGACAACGCCACAAGACAGTTGCGG
ATATCTCCGGGTGGCAAAATCCCAAGGTACTTGCGGAGAGCACCAGAGTGACGACCAGAGTCAAATACTACATTGAAGGGAACAAGAAATTAATGAGCAT
AGTCATTAGACGTAGCAAAGAATGGATTGCATACCTGTCACGACTGCAGTAAGATCAGCAGGATAGTGACGCAGCTCTTTGAGCAGTACAGCCAAACCTG
TGCCACCACCAATAGCTACGATCTTGGGTTGCAGCATTTGCTGGTCTGCTAGCTTTACAATCGGTACAAGCTGCTCAATCGACTCAATCTAGCATCAAAC
AACAAATAGTTAGTGCATTGTTCGAGTTCGAGTGATCCAAAGTCTTTACCTGGAAATCTGGTTGTTCCATCTCGTCCGTTGGCATGACACTCGTGTACTT
GCCAAATAGCTAAAGACAAACATCACCAAGGTCAATCAAAACCTCCAAAGCAAGTCCTTCAACCACTCACCATGCGGACAGTGAGCATCCCGACAGTATT
CGCCGCCTTGATCTCGTAGAAAGCTTTGCGTCCCACGAACATGACAGCAGACGATGGTATCTCCAATTGTCTCGCGAGCTGCTTCATAGCACTCGTCACC
TGTGCCAAGCTCGGGTTGGGAGTCACATAGACTACCTGATCAAACAGATCGTCGACTCCCAAAGCTTTAAGTCGTTCACGCTGCACTTCTGGCTTGCCAA
TCAACAGCAACGCCAAGTGACAAGCACCTCCGTCCTTTAGCTCCAATAATGTCTTGCGTACACCAGAGAAGGGCGTAATGCTTCGTGCTTCAGGCACATT
ACTCTCGTAATAAGCAGCAATGACCCGTTGTGCTTGAGTCGGCGATAACTTGGCTTGGGGACCACCCACAAGGCTGTCGACGAAGCGGGGGAAGCGTTTG
CGGAGACCGTAAGCGTTGCGAAAGGTTTGCAACGCTTCAAAGGCTGCCGCGTTGGTCGGGAACGCGCCTTCCGTCAATAATTGAGCGACACCTCGGTCAA
TCGCCAAGTGTGACAAGAGTCCGGAGTGGTCGTACAGCACATCGTCCAAGATCATGGCCACGGCTCGCACGCGACGACGGCGCGGACGGGGTGGAGAACC
ATTGGGGACTCGCATCCCGCTGGGAAGGCGATGCAGCGGGTGCTTGGATGGAGGAGGAATGACGTCGGTCATGGCGTCGCTTTGACAGACGAGGAACGAG
GAACGAGGGGCTCTCCAGGCAGAAATGGAACGGTCTCTTCTATCGAAAATGGATGTGCATCTATGGGTTAGTTCTGTGTAGTTACCGACGCTGCAACATG
CGCAACGCCATCTCTTCCTGACTGGCTACGGCTTGGCGATCCACCTGCTTCTTGTCATGTGTCTCGTCCTCGCTTTCATCTTCTTCACTGCTGTCCTCGT
CACTGCTGTTGTCACTGCCACTCATGTCTTCGTCATCGGAGCCCACTGCAAGACGCGGGCCTTCATCCTCGCTCTCGTCGTCGCGTTCGCCCTTGATTTT
CATGCGTTTCTTGTGGTGCTTGGCACGCACACGTTCCTTCTCGAGACGACGATCCTCTGCGTCCTTGGCAGCGAGACGAGCTGCTACTTGCTCCGTGTAG
TTCTTGGCATGCTGCTCCACGTCAGCGAACTCGGCGTCACCGCTATTGCGTGCTGCAAGTCGGTCAGCCATCTTGGCACTGTTGCCCTCCTCATCGAACA
CGATCTTGGAAGCGTTGATGGCCTCGCGGTCCACACGCAGCTTCTTCTGCTTCTTCTTGCTGGGTCCAAGTGCTTCCAGGTCCAAAGGCTCATCATCTTC
ATCCCAGTTGTGTACTCGTTTGACAACCATAAGCGAGTCTTCCTCCTCTTCGTCTTCGGACTCCTCCTTCTCTTGCTTCTTCTCCAGCTTCTTTTTGGCC
TCCTCCTGCTCCTTAGGACCCAAAGCAGCCAGCTGCCGCGCCAATCGCTTGCGCTCCTTCTCAGCCTTAATCTTTTCCTTGAGCTGCTGAAGCTTCCGGT
TGACATTCTTCTTTCCGCGAAGTTCCTCACGCAAAGCCTCGTTGCCACCCTTCTCGTGTTCAGCCTTCATCTTGGACAAGAACGGCATGCGTGGAGCACC
AGGAAGGCCCATGGACTCGGCAAACTCGTCCAGAGGCAGAGCTGTAGCATCAAACACCTCACGATCCGGCTGCAAGTATACAGAGCGCACATAGGACATA
AATGCCTTCTGTGCTAATGCTTTAATTTCCTTGTCACCTGCCACAACGGACGCCACTTTTTGGCGGCAGCTCGTGGTCTTGGCTGGGTTGAGCTTCGTCT
CGCGGATGGGCACCTTAGCCTCCTCAAGGCGCTTCGTCATACCGTCCACCTCAGACGGCACGAGACACATCAAAGCTTTGCCCTGCTTGTTATAACGAGC
TGTACGACCGACACGGTGAATGTAGTTAGCAGCGTCTTCAGGACAGTCCAGCTGTAGTACCCAGTCGACCTGAGGGAAATCCAGACCGCGTGCCGCAATA
TCCGTGGCAAAGAGAACCGCAGCAGGTTTGTTCAGGAACTCGTAGTACACTTCCACACGCTTGCCCTGTTTGTACTTACCGTGCAACGCACAAAGCGGGA
TACCAGGCTGCAACTTGCAGAAAACACTGTGCACATATCTCACTTGTCGGCATGTGGACAAGAACACGATTGTCTTCTGTTTCAAGTGCGACTTGATGAA
CGACAGCAACACATCCAATTTCCGCTCCAGTGGCGTCACCACATAACTCTGTGAAAGTCCCTTGGGCGTCGCGTTCGCCGAGTGTTCGTGCACAGCAACA
TATTCAGGTTCTCTCAAACTCAACGCAGCCAGGTCCTTGACGGATTTCGTCTGCGTGGCTGAAAACAGCATTGTCTGTCGTTCTCCTGCAGGTGGCAAAT
GCTCCAAGATGCTCGTCAATTGTTTCTGGAACCCCAAGTCCAAAATCCGATCTGCTTCATCCAAAACCAGCACTTGCAAGTTACTAGCATCAAATGCAGG
CGTCTGTTCCATATGTTGCAGTAATCTACCAGGGGTACACACCAGCAGATTCATCCGTACGAGACGGAGTTGCTCCTCACGAAAATTTTTGCCTCCAATA
ACCAAACCTGCAGAGAACGCGTGAGCTTTTCCCACATTGCGTAGCACCTCAAAGATCTGCAGTGCTAGTTCTCGTGTAGGTGAGATCACAAGTGCTCCAA
GTCCATCTTCCACGCTCCACCGGAGACGAAAGAGCTTCTCCAGTAATGGTAACAGGAAGGCCAGAGTCTTTCCAGAGCCTGTTTTAGCTGCTGCGAGTAC
ATCACGGCCCGCTAGAGCGTGTGGTAGTGCACCCACTTGAATCTTTGTAGGAGCTGTGAAGCCGCAGGTTCTTAGACCACGACGGGAGGCTTCAGACAGC
GGAAAAAGGTCAAAACTGGCGGCTTCACCGAGCTGCGAACCTCGCGCAGGCGTTTGTTCGGCGATACGGGCTTCTAGACGCTCGATCTCGGCGCGTTCAC
GCTCATTTTGCTTGAGTTTAGCAGCAGAGACAGCTTCTTCTTCTTGTGCTGGAGGATTCGGGCGGCTATAAGCCTGACGGAATGCACGCGACGCCATAAC
TGGGAGCTTGACGTTGCTATTGGAGCTCTTCGAATGGCTGGTGTAAGCGTGTATATATGTTTGGTACCGTAATTTTGGTACATGGGTACAAAAAGGACTG
TAGCCATGTGACGAGGCGAACTGCAACGTAGTAGTTACTTGTACTATTCTGACTGCTTCAGTGTGCTTTTGCATCGAGTGTAGTCATGGAAGATGACGAG
GTGAAACTGGTCCGGGTGCCCGTGCGGGAGCTTAAGACGGCTATGGATGGAGCCAGGGCGGCGATAGATGAGAATCGTAGATTGGCTGAGGAACTTGCAC
AGTCGGAGGACGAGGTGAGAGAACTCGAGTTCAAGCTGGTAAAAAGGCAACAGCAACTGGACTGCTGTCGTTCCGAGCATCGTCCGTATCGACCGGGTGA
CTTGTTCAAGTCCACGCCTAAACGTTTACGGCCGAAAAGTGAGCTGTTTGGGAATAGTATGCGAAACCTCATCGGAGTGCAAGCGGAGACGTTGAACCAA
CTTGGAGAACGGGAGGAGAATGTACGTCGACGCATATCAGCGCGCATATCGATTGCTGTATCACTCACCGACACTTTTAATGGTTAATGCAGCTCCGTGC
ACTCATGGACGCCATGCGCGGGATTTCACAAGCGTCGGACAGTCTAGACATTGTGAGCAACGCACTGCGCGCTGCGCAGCATGCGATCCCTGCCGAGAAG
TACACTATAGGAATCCTCAACGAGAAGAAAGATCGCGTCGAACTCTACTCGAATCCACCGATGGACTTACTAGGTAAACGCTACCTCACTGAAGAAGGGA
GCGTCCTCGTCGATTCAGCCACTACATTTGGTCGCGTTGTGTTGGTAAATCTTGCGGCAGATTTGATGTGGTGTTCCCTTGTCTGACCTCGTTTTGTCTT
GTTGTGCGGAATTCCAGACCGGAACCCCTCTCGAGGTTGCAGATGTGAGCGGTTCCGAAGTGGTGGATGTGTTTGAAGAACAGATGGAGCTCCTGGACTT
TGAGCCTGAGGCATTGCTCTGTGCACCAATTTTCAACGTTCACGGAATATTGGTCGGAGTCTTTCAGATAATTACCCGCAAGCAAGTCCCAGAACTTGAC
CGCTTGTCCACTCCAACTCCCCCACCGGAGCCTCTCTGGTTTTCATCGACATCTCGAGCTGCCTTGACAAAACTAGAACGCAACCAGGGAGCTCAACAGA
AGGGAGCAATTGATCCACGAGAAAAAGAGAGTTTCGACTACATCTGCGTGACTGCAGGTACGGCTTTGTGGAACATTTCGCTTGCCAAAGCACACCAAGC
CATGCAAAGTCGAATCGAGTGTCTTCTCAAACTCAACCGAAACATCGCTGCAGAAATCAGTGCGTCTGCAGTGCTTCACCAAATCATTGCCGTGGCTTAC
GAACTGCTGCACGCGGAGCACATTGCACTATATGTGTGCGATGAAGGAACGGACGAATTTTATCTCTTCGTCACCGAACACAGGGATGAGCGAGCCACTA
CACCATCTGTAAGCCCCAAAACTAAAGTGAAAGTGAAGGACCAGGTGAGTGAAAGACCTCGTCACTCGCATCTTCGACATGGTAGATATGATGAAACCTT
CCTGAAAGCGCACAATGGTATTGTAGGCGTTGTTATGCGAACTGGGCAGCTTGTGCTCACAAACTCAGCTCCAACTCACCCAGCATTCGACCCGAAATTC
GACGATCTGTGGACGTCCCTGAAAACGAAGCAAGTGCTCTGTGCTCCCGTCAAAAATGCAAGTGGTCAAGTTCTCGCTGTTGTGTGTGCTACCAATAAGG
TAGAAGGCGATGAGTTCACATCCGATGACGCCCTCTACCTCAATTATGCTGCAGAAGCTGCAGGAATTTCGCTGCACAAGTCCAATATGCTACGCTCAGT
AATGATGTCGCAGCGGCTGACAGAAGCTCGGTTGCAACTCGCTGATTTCGTGAATAGCAACGGTGAACGTGCTTGCAATAGCAGCTCCAGTTCCGGCACC
AACGACGAAACCAGCGCTGCTGTCTCAGTAGCTAGGTTTGTTCGTGTTGTCATGGTTGAAGGGAGAAAACTGCTCCACTGCGACCGATTTGGGTTCTTAC
TGGTGGATCCACTAAAGAAAGAGCTTTGGATCACACAAGAAGACGGAGAGAGTGTTCGAATGCCACTTACCAATGGTCTTTCTGGATTGATCGCTACCAC
AGGAAAAACTGTTTGTACGCGTGACGCATACACCCACCCACATTTTGACTCAACACTCGACCGCAAGACCGGGTACCGCACTACAACGGTGCTAGGTATG
CCTGTGTTCGAAGACCACACACCAACCAACCCCAAAATCGTAGCGGTAGTTATGGCCATCAACAAGAAAGGCGACGATGACGATGGAACGCAAGATGAGG
AGGGTCCACCTCCCATGTCAAGACATCGCATGCCGTTCACTGTTACTGACGTCGATTGCATGACTCAATACTGCCGAGAAATTCAATTCGCGCTCGGGCG
ATTGTCACTGGACATTTCGTACTACAAGGTGGTGTCAGATTGCGGACTTGGTTTACCTGGTGAGGCTTTGGCTGAATCCGCAAACACATCTAAAACACAG
GAACTGCAAGTTGACGGCGTGAATGAATCAGAGATCGTCTCGTCGATCGTGCAAAAATTCTGTCAATCTAGCGAGCTGGACGCACTCGAAGATGTAGCAG
CTACTGCTATTGCAGACGACCCAGACAATGTTGACGACGGGGATGAAGCAAATGGCGGGGTTTACGACGA