Description :
From Genome Similarity Track
Location :
Scaffold_223:2088- 4990
Sequence
2902 bases(100 bases per row)
ACGAGAAACACCGCTGTACCTCCCGTCGTCGGCTTGGCCTCATACGCGCACTGGTCGTAGAACGCCGCATACGTGAGATCGTAGTTGGTTTTACGCGTGG
TCGCTCGCCAAGTAGGCGTCCTGTCCTTAGCGGGCGCTTGCCCCGGTTTGCCTGGTGCTTGGCTCGCTTTCGCGGGTGCAGGGTCTTTAGCGGGCGCTTC
AAACTCGATGCTGCCGCCCTTGAACGTGCCCGGCATCGCGATGACGAGCGATCCAAACACACCTTCGCCTTTCGACTCGCCTTCGCGGCGCACTTGGAGC
CGCGCGCCGGCGTCCTGCACCACCATCTTGCTCAGCGACAGCTCGATCGCCGCAGCTGCAGAGATGCCCAGCGCGCCGCGCTTGGAATCCAAACACTCCT
TCAAGAACTCCTGCCAGCGCGGGTTGCGCTGCTCCAGCAGATCACCGCGCACTTCCCATTGCTTCTCCTGCGCGGCNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACTTGATCTTTTGCTCGTCGGGTTTCCCCAGGGGGAAATGGAGT
TCGCCGTCGGCGTCGCCCTTGAACGCGAGCCCAATTGGCGGGTACCGCTCGCTCGTGCCAGTCGCCATGGGCGCGCCCACGCGATTGAGATTGTCGAGCG
CACGCGCGACGCGCTGGAGCTTCGGCTCGTAGAGATACGCGGCGACGACCGCTTGCGCTTGCCGGTCTTGCGCGCCATCTCGGCAGGTTTCTCTTTGGTT
TCAACTCCCGCCCAAGATATTATCTGGATAAAAGCAGAGAAGCAGATATTATAGCCCGCTTGTCCATTTCTTGAAAATATGTGGATACATATCTGCCATA
ACTGTAAATTCTAGATTGATTTATGTATCTCATTTTTGGCCCAGCTCACAAAGAACCACCATGGGAACTCACTTGTGATTCCATCGCATGAAGCATCTCC
TCGGCTCGCGTTGTGGGGTAAAAGACGCCGTCCAATTGGAACTTCAGCTTCTTTTCGAGCCGCAACGTAGTGGCACCGACGACCATCTGAATCTTCACCA
CCCCCGGATACACCACTTGATTGCGAAGCATCGCCGCGATGTGGTCGCACTGCTCCGAAGCGTTTGCGTACTGCATAACCATCTGCGTCGCTGTTGATCT
CAAAAACGAGTGGAGTTGGTCACACGTGTCGCAGTGACCCGTAGGAATCTGCACGTCAGCGAATGGTCTGTTGCGGACCACAGCCGCCATCTCTTGGAAG
AGCTCCGAGACGTGAACCACGACGGGCTGCAGCGACTGAAACTCATCGTCCTTCNNNNNNNNNNCGCGGCTTCGGCGTTCATCTTTCGGGCGGGTGATCT
TGTTGAGCGTCTCTTTTGCTCGTTCCATTGGGTCATAGACAGAATCCCCACGGTTCTTGGTGAGCCGAGCAGCGTTGCCACCACTTGCCCGGACAGACAC
AGTAGACGGATACTTCACGTGAGACTTGAGCACCGACTGCATGTGCTTGATCTGAGGAGTCGAACCGGTGAAGGGACAGTTGCCTCCGTTGCCGGTGACA
GCAAGAAGGCCTGCACTGTCTCAGTTGCTGCAGTGCGCGGGGAGACGAACCTTGGCGAACACGTCATTAAGAACCACAGCATGCATCTTGTCCAGAAGCT
TCGAGACGTGATCCACTAGTGACTGCAACAACACGCGGTCCATGTGGTTCTTGAGGCTCTCGAGCGCCGGCACGACGACCTTCATCAAAGCTTCTGGACA
CGTCACCGACACCATCTGCTGCAGCTTGTCGGGAGAAGACGCATTGACGCTTTTGAGCAACCGAGAGAAGCTGCTTTTGTCAGAATCGTAGCTCTCACAA
CAGGTCTTCAGACTGGTATCGACGATGACATCCGTCCATGGGTGCAGCGAGAAGAGCGGGTCTAGCAATGCGTTGGTGCGCGACGAGTCTGACGACGCAT
CAATGATCGCACCAATGAGATTGCAACGGCCACGGAGGGTTGCTGTGGAGAGAATACGCTTGACAATCGTGTCCAGACACGCGTCCCAGCCAAAGTGGCC
CACCGCAGGGCGCAGGGAGCCAATAGCGTCGATTCGGGTGAGGATGATGTTCAGAAGCATGTCCTTGAAGAGCTGAAGATCGTTGATGTCGATGACGACA
GCAACAAAGTTCCGGAGCATCTCCTCGCTTTTGGATTCCTCTGTCCATGATGATGAATGGCGAGAAGCTCTCGTGTGGGAGATGTGGCATTCAACCTTCC
ACGGTGAACGGTAGCGAAGCACACGGCGTGCGTACCGCAAAGCCTCGTCCCGCGAGTCCGGGAGAAGCGCCCGCAACGTTGTTGTGACGTCCTCGATTGG
CATTTGCGCAAGCTGAGTTTGCTCGATCGACGCGGGCTGAACGACGAGCGCAAATGTATTACCCACTCCGGTCTTCCGGAAGTTGTAGTGGATCTTCTCG
ATAATATCGTAGTCGTCCATGTCCATGTCGTACACTTGCACGTAGAGCTTGATATCTTCGGCTCGCCCCAGCGGAGTCACATCGCGTTTTTGAAGTACTT
GCACTGGCGGGAAGGTGCGCACGACGGAGTCACCATACTTGACCCACGGCGTTTTGAGTGTCAGCTTGAGGTCGCCGTCGCTCTCGTCCAAGGAGCTATT
GTGGCCATACCCTTTGTAGTACTCGGACTCACGAGAACACAATACGCCAGCATGGTACAACACAAATTGGCCATTGCTCTGAGCACAGAATGCCGCAAGA
CTCTCTGCGACTTGGCGGTCGTCCCCACTGAGAGTCGTCGATGAGGTGCCTTCGACAATGTGGACAAACCGACGTTCTGAAATGAACTCGTTGATCGTGC
TC