Description :
From Genome Similarity Track
Location :
scaffold_33:20876- 23512
Transcript NameFunction/comments
Pl_111626WD domain-containing protein, putative
Pl_111627eukaryotic translation initiation factor 2 subunit 3

Sequence
2636 bases(100 bases per row)
GACGATTCTTCTCTTCCAAATCCGATTTGGTCACCAGAATTTCCTCTGCGAAGGGTAAACCTGAGCCACTCGCACCACCGCCGCCACTAAGCATTGCACT
ATCGCTTCGTGTTTCTCTAGTTCCAACTGCTCCACTCCCTGGGCCACTACTAGCACTACTTCCACTTCCTTTTCCAATAACATTCTGCGTCTCAAAGATG
CATAACGAGCCATCTTCACCTGCAGAAAATAAAAACTGGTTGTCAAACGATAGCCGAAGTCGTGACACCGGGAGATCATGACAATGATATTCGGTGTAAG
ATTGGGATACTGAACTTGCCCCCGTTGTAGCAGATACTACTGCTAATCCAGTTTGGCCTGTGGGCAAGATAGAGCCTGGTGAAGTAGATGACTGTACACC
GCTCAATAATCCAGATGCAGGTGGCTGGTGATCTTTCTCCAATGGCAAACGGTATAACCTCACCATACCAGGACGACCTGGTTCTGCTGATCCAACGAAA
AGTACTTGTTGAGAATTAGCGAGGGCTAGCGGGCCCAAAGTAACCCCATTATTGCCAGTCCAATGTTCGGCCCTTGCAAGACCCGTGGCCATATCAATCT
CTTTCAGCATATTATCTGAACCTGTGGCGTAAACCACATCTCCTTCTGGGGATAATGCAGCATCAATGTACGAACAGCGAGCCTGTGAATGACCATCACC
AACTTTAGATGCTCCACGTAGGCTCCACAACAGGACAGTGCCATCAGCACCGCATGAGAGTAATTTCCGGTCGTCAGGCTTCCATGATATTGACGTCACA
CGATTGGAATGTCCGCGCAGTACAGCTACTAGCTCGCCAGTGTAGGTAGCATACACATGAACGACATTACTGTTGGCCGCAGCGAAAAACTGACCTCCGT
GTGAGAATCGAACCTCACGACAACCTTTGATGGAAAATTCACGACAAGAGCGAATGTCATCCATGAGGACGTTAAGCATTCGTAGCTTGTCGGTAAAACC
CACAACAACGTGCAAACCCGACGGATGAAAAGCCACGCACAATGCGTCTTCACGGAAGAACTTGAGGATATCTGTTGACTTGTCTAAGTAATTCCACACA
CGCACAGATCGATCAAGTGCACAAGTGACTACTAGCGGCTTGCGGACGCACGTATCAAGCCCGGTGATATGACAGCTTCCATTGCTACTTGGTGCATGAA
ATGCGGTCGAGACGAGCTCGAAATTCATGGCATCTTCCTTGAGAATATCAGTGCTTGAGAGTGTGAGTGCATACATCTGGTTGTTTTCAAGCGAACAAAC
GAGCAAGTCTTCACTCGGACTGATGGCCAGATCCTTGATCGTGCTGGTATCGCCTTCGATTCGAAAAGTCTTTGCCTTCTTGTAATACTCGCGTGACCCT
CCGTCATCGTTTCGGTCATAAATGCGCACACATCCGCCAGAGCCACCACAAACAAAACCTTTCGAGTACCCTAGTAACGAGTTCATAAAGCTGCCATCCC
CTGTCGTGCCAGTCGTCGCCGGTGTCAAGATTTGTCGAAATTCAAACTGCTCAAACAACCACAGCTCTCCTGAGTCTGCTGTAGCTACAACACGGTCATC
TGACACCCACGCGTGTCGTAAGAAATGCGCAGGCTCGCGTTTCAGTGGCGTAGCCTGCAGTCTCAACTGCCCGTCAATCAACCGAAAGAACTTTAACAGT
CCGTTGCCACTTGCACAAATCGTCAGGGGGTCATTTGGACTGAAATCTGCTTGATGTACGGCATTGCCTTGCGGTGTCGAGGCTTTGACACTTGCAAGGA
GCTTGGTTTTCTCCCACAACCAGAGCGAGAGTATCCAGTCTGGTGCTCCTCCTTGTGTGATGCAGTACTTGCTGTCACCAGAGAAGGCCACCCACACACA
CGTATCTGCCAGTCCGTCACTGAGTGTCAGCGTCTTGCGGCGTCGTAGTGTATTAAGGTCGTGGATGTGCACCACCGCCCGTTCCGCTTGCTCCGCCACG
GCCACGTAGCGTTTATTGGGCGATACAGCGAGTGCCGTGATACCGCGTCCAGCAGTTTCAACACCATGTAGAAACTGCTGCTCCTTCGACTCGAGATTGT
AAATAATAACGTTGTGACCGCACGGATAGACGAGCACACCCTCCTCCGCGAACGCGACGTTGTTGTGGACGCTGCCCTTAAGCCCGAAGAAGTGGCTGCA
GTCGGTACCAGAAATACGTGAGCACTAACAGAGGATACAACTGTAGTACATGAGCTACTTACCGATGGATGAGTCCTGGTGCGCTGCTGGTAGTGGCGCC
GCCCGCCATGCTGAGCTTAGTGCGGAAGTTGAAGTGACCTGTCAAGCAAAACCGATGTGGTGTCCACCACACCAGGTAGTGTCCACCACATGAATCCCCT
GAGCTCTGCACAGCCACCATTCCCCTTTAGCGTCCGAGGCAGAATCTACATCGCGCAGGTATGTGAGAAGGACTGGGACGTGAGAGGCAAATGGTCAAAC
TAATACTACGATGTCTCACAAGTGCAGACCTCTACCAGCTACTCAAACATGCCGGAACTCGTACAGAAGCACCTGGCGGTGCAGAATTTGACGAAGCTCA
AGATCGAGGAGCTCACTCCACTCACACCGGAAGTCA