Description :
From Genome Similarity Track
Location :
Scaffold_68:20875- 24882
Transcript NameFunction/comments
Physo_138910reverse transcriptase
Physo_138911hypothetical protein

Sequence
4007 bases(100 bases per row)
CAAGATCGCGGTCGGCGTCGTATACTGAGGCCGCTCCACAGCAGGCTCTTCCACACCGGCAGGTTCAGGCACATCGTCCGCAGTGTCGGTGGTTGGTTGG
TACGCCAAGTTCTGCCACTCAGCGTAGCGGCGAGATCCGACGAAGATATACCCAGGTAAGCGCAGCACTCGATCTCCGGACAGCCACATCACGAGTCGCA
TACCTTGATGCAACGCTAACTTGCGTTCGCTGACGTTTGTCAGTTGCAGGTAACGAGCCCTGCCCGGGCCTGCAGTCACGGTAGGCACCCATCGATCGCC
ACGTGTGACCCAAAGCTTCTGATGCTCTGTTGGTCTCGTGCGCAGCTTCACCTCGGTTGATCCGGCCACGTCGATATCGCAATAGTCGGCCAAGTTCACT
TGCTCGACCTTGTCACCGTAGAGCGGGCGTCTTCCAGCAAGCTGAATTCGCACCTCGTCCGGCAGGAAGATGGTTCCGTCGGCAAGATCAAGGCGGATCC
CGGCCGGCACCATGAAGTCCATGCCGAGGATCAAGTCTTGGCCGCCGGTCGGCGGCCCCACCCAGACATCGAAGAAGTACACAAGCGATCCCGCGAGCGT
GATCTTGACCCGCGCACGTCCTTCCGCCATGTATGGAGATTTTCCAACGCCTTCGCACTCCAATGTCTGACTTTCATCAATGTAGCACCCCATCTTACGA
GCAAAGGCGGTGTCTAGGATAGACACTTCGGCACCACTGTCAAACAACAGAGTTGCTTTTTCGTTGTTGATCTTGCCCAGAGCTTTCGCTTGCTTGAACT
TCTTGTCGGGCACATGGTATTTCCAGTAACCACGCGACTCCCCCAACGCGATATCCAAGGCCATCTTCGCACTCGATCTTGAGTAGTCATCAACTTGGTG
AAGGCTTGACACGGCAGCCGTAGTTTTCTTTTGAAGATCACATGTATTGTCGATGAGTTTGCTTACAGTCGACTGTGACTATACGCAAAGATGCAGAACT
GAGAACGCTCGTCTCGTACCGGATTCCAACCCGGCGGGCGTCCTAGTTTAACATCTTCTCCGCGGACTCGGGCAACATGCCCCCGTGCTTGGTGGAATTG
TACCACTGGCAGATCAAATTGTAGAACTCCTCCATCGGACAGCTCCCTTCGTCGTGAATTTCGCCACAGGCTTTGCAGACAAAGAGGCAGCGATCCGACG
GGTGACCACGCTTGCCGCATTTCTCGCACGTCAGCCGCTTCCAACATCCCAGATCATCATGCTTGACAGAGTACACCGCTTGAGGGGCGCTCCCATGTCG
TTTGGCTTCAAGTGTTGTCCGGGCCGACGATCCTGACGGTTGCGACCTTGTTCTGGTAGACGCCGGTCTTGACCAGAGATACGATGTTCAGTCGCTCCGT
TGCTGTTGCCAGCCGCGGTCGCGTACACTCGGCGCAGATCTCCATCTTCATCCGATCCACTTGATCCAGAGTCGGCGTCACTAGTGTCACTCGGTATCTG
GATCGCTCGCACTGCGCGGGTACCGGCGGTAGCTGGTGGCTTCGGACGGGGCTTGATCGAGCCATACACTGTCTTGCTCTGCCGCGCCTTGGCACGCTGG
CGAGATCGCAGAACTTCTTCCAGGGTATCCGCATCAGGAATCCGCAGCAAGGCGAACTGGTCCGCTAGATCGCGGTCGTCCAACGTCTCGATGAAATGCT
CCACATGTTCCCGGTGCACGTCAGGCGGACCGTCCTTGACTTGTAGACGTGTCCGCAGGTCTGCGACGTTGAGCCTGTGGAGGTACTCCAGAGGCGACTC
GTCAGATCGCTTCCGAGCATGGTAGTACTGGCGGGCAACCGAGACACCACGACCACAATACTGGAGCTGGAAACTCTGGAGCAGGTCCTTCCACGTGGTG
CGAGTTGTTCGGCTCAGCTGTCTACACCAGTTTCTCGCTGGACCAGTGAGCAAGTCGCCGAACACCAGACACTTCTCATCATCAGGTGCTTGATCGCGGA
CGAAGGCCAATCTTACCTTGCTGACCCAAGCTCGAGCTCGATCTTCGTCGCCGTCCTTTCCGGAAAACTCCTTCAGTTCCGACATTGCAGAAACACGAAT
GCGTGGTGCAGACTCAATTCCTCCTGGCGAAGCCGTAGCTGTCGCTGCGATCGCTGTGCGGACGGGTCGACCAAGATCGAGGTCGTCAGGATCGAACTCC
CATGACGTAGAGTATCGGTTTGGTGATCCAACCGACCCCATCTCCACATCTTGATCACCGGTCGGTCGCGACTTCAACGCGATAGCAGGTAGCTGCTGCT
CCTTCAGAAAACGTTCCATGGCCGCTTGGAAGAATGACTCGAGTTTTTCCGGTGAGTGTCGCGTCGAGGTTGCTGTGGCCTTCGGCTCTCGCCTTGGCAC
CGCGGCCTCGCCCCCAGCACGCTCGGTTCGACTTCGTAGCATGGCGGCACCGGAAGGACCAAGCGTCATACGTGGCGGCGGATCATCGACACTATCGGAG
TCCACGTCTTCCGTTGCAGACACGTACGGAGATGACGTCGGAGTTTGGTCACCCGGGTTGCGCGCAGGCGTCGATCTGGCGGGAGTCGATCTCGATAGCG
TCTGAGGCGATCTTGATGTTTCTTTCAAGGATCGACTCGATTCACCGACCAACGGCTTCAGTAACAGGAACAGCCTCTGGGTCGAGTTCTGGATCGTGTT
GGGCTTCAGATTGAACAGGCTTTCCGCATCCAGCGCTCCTGCGATGATGCCAACTTTGAAGAGCCATAGCAGGGTCTGTACGGCATCCAACTTGTCCGAT
CCAGGGGTCGGCTGTGACACCGGTCCCGCAAGATCGCCGAGGAGCTTCGGCCGGAGGAGCTTCATCACGTTGTCCTGAAGCAGGAAAGCGTTCAGCTCTT
TCTTGTAGTACGTTACAGCCAGTTGGTCCTCAACCACGGTCGTGAGATCGGCTCGATCGTCAGCATCGGAGTCTGGAGCCTTCATCTTCTTCCGACGACT
TCGATCCTGCTGGCTTCTTCTTGGTCGATCTAGCGTTGGGTGGTTGGGTTCCGGCTTGCACCGGTGGACTTTCGTCCGGCAGGTCACGATTCGCATCGTG
CCCTGCGGGGGTCCCCGAGGGGACCTGGGGAGGAGGTTGAGGTTTTTCTTCTAGGTCCGTCGCCGGACCTTCCTCTGTTCCGTCGGTAGAGCTCCTCCCT
AGGCTCTGCCGATCCGCGGATCGATTATGTTTCAGCGGCGTCGATGGCGATCCGATCTCTGTCGACGTTTCATTCCCTTGTCCAAACTCGGCTTGCGCAT
CCGCTTGTAGGGACTCACGGTGAAATCCCGAGTCACTCAAAGATCCGGGCACGCGCACCATTGTGGCGAAGTGGATCCGCGAAATTTGCAGATCGCGGGG
GCCCTCTTGCACACGGCGCCCGAACTGCCGACTAACGGAGGGGGTACTCCGATCTTCCGTGAAGTCGCTGATCCGCACCTTGTGTACCCGTTGGTGGGCT
GGATCGCTCTTCGGGTGATCTCGAGAAGGTTGAGTCTTGGACTGTCTGGTGGACAGCGGGAACTTGTGGCAGCAACGCGGATATGCTTCACGCTGTGCCG
GAGTAGTTGTGGCGGTTTCGATCTGGGGTTGTCTAGATCGACACTCGCCGGCCAGGTGTGATCTTGGCCTGGGGTTGCCTTGTGGTCGGTGAGTGACCTT
CCTTTCCTTTCCTTGCTTGCCGCTTCCTGTAGCGGTGGGTCGAAGTGAGGGTTGACGGACGCTGGGCCAAGCTATCCTGTCGTCCGAGGTTCCTTGATCT
TGGGGTGTAAGTCGACTCGCGTAGCGTCGGGTGGGCCAAAGTATATCCCGTGCCCGGTATTGCGAAGGCGAAGACCACTTGTGAAGAAAGAGGTAAAATC
AACTCTGTTTAAATGTTAGCTTTGCCTAAGTCCTTGTCCTATCGTTCTCGTGCTCTCTTATGGTCCTGGCGCGTGCTCTCTGGCTCCCTTGAACACTGGT
GGTGCCG