Description :
From Genome Similarity Track
Location :
Scaffold_412:20875- 22583
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_412-snap-gene-0.10Conserved gene of unknown function

Sequence
1708 bases(100 bases per row)
GATGGCGGACCAGAAGACGCGCAAGCGCACGGCACCGGCTTCCCCGCGGTCACTGCTGCGATCAGCGCCGCTGCTGAGCTCGCCGTGGCTCAGCCACGAG
CTTTTTCCGGCGACCAAGAGAGTCGCGAGCGCGCCCGACGGCCTCGCAGTCGCCAAGAAGAGCGCGGTCGCGAAGGTGCTGCAGGAGCTGAAAAAGGGAA
GAAAATACGTTGACAACCAGCTCTTGCACCTGGAGGCGCAGCTCGTGAATGTGAGCGATTTCCTCGCCAATAGCGCCTCGACGAAGCTGTTCACTGACTA
TGGACTTCCCGACGGACAAGTGTACGCGACAGAGAATGGCGCTGCTGGAGAAACTACAATAGGGAATCAGATGATGGACGGCGAGGAAGTCCCAACGTCG
CCCAACTCAGCTGGACTCCGCAGCAAATTCGTGCAGCACAACTTTCCTGTAACTGCGACAACAACGAGCTCTACAGCTAACCCACTGAACCCTGCGGAAA
CGGTTGAAGACGACTTGGCGTCCGGTACGTCGCTGTTTGTGCTGATATTTGCAAAAAGCATATGCTTACGATGGTGGTGCTTGGTTAATCATGGCTCGGC
TTTTCGCTATACTGCAGACACGCCATGTACGACAATTGGGCTGTGGAAGTACTTGAGTGCCTACGAGATTTTCAGAAACGTGACGCTCGAAGATGTCGAA
GTAGCATTGCAACTAGAAGGTACAGGCTGCGTCCAATGTTCAACGCATTGGTGTATCTGTGGGTGAATGGTGCTAACGTTTTTGTATGGCATGCAGAACC
GAATCCGTTAGAGAACGATAGAGACCAGGAGCTTGCAACCGTTTTCCATGAGCTCGGCGATACGAAAGACACGGTGGAGAAAGAAGATGTGTCAAGTGGC
TCGCCCATGGACGAATTTTTGAAAGCGGTGCGCCATAACTATACATGCGAAGCTACCAACAAGCACTCTTCTGATTCAAAACATTGTGTGTTTCTTTGTG
TATGCAGAGGCTTGTTGCTGCTATTGTACCGATACCAAAGCAGCATGTTCGTGCAATTGAGAAATCATTCATTGAAGAAAAAGCGGAAGGTAAACAGGAA
GTAGAAGGCGACTCGAATGGACGTTGTATAAACGAAGAGGATGCCCACAAGAAGGAAAAGATAGAGGAAACGTTTGTGGAGGAGGACAAGGTTGCTTCCT
GGAGTGCTGGTGGAATCAGTACTGCGCTCCGAGACGCTGGAGTTCTTGAACTCGACGATGACGAAGTGCGAAAACGCATGCAGTATCCCGAAGACGACGA
AGTGAGCAGCGAGATCCGATGCCTGGAAGAGACGCTGCGAGAGCAGATCCACCAGAGCAATGAGACCAAGCGCGTGTTGCGGAATCTGCTACAAAAGTGC
GTGCATGAATCTGTATTGTTCTAATGTTTCGAGGTGACGTTGTGAGTGGAAGTGATTCATTCTGACTTGTGTGACTTTGTGCTCCTACGTTGTATTCAGA
CTAAAACCGTGGTTGTCGCAGCAAGAGGAGCAGGATCAAGCAACTGAGAAGAAGTACCTGAGCATGTGGCGGCGGAAAAAGGTATGTGAAAGCCCACTCT
TGCCTAAAAGCATTTTGGTTCATGATACCTTAACCGAATATACATCTTCTGTAGGAACTCGAGCGGAAACAGAAACTCAAGGACAAGAAATTGATGCGCA
AAGAAGGT