Description :
From Genome Similarity Track
Location :
Scaffold_33:208748- 216771
Transcript NameFunction/comments
Phyci_273752Hypothetical protein
Phyci_308546calcineurin-like phosphoesterase, putative
Phyci_103878conserved hypothetical protein
Phyci_458470conserved hypothetical protein
Phyci_92427conserved hypothetical protein
Phyci_92428hypothetical protein A1Q1_01194

Sequence
8023 bases(100 bases per row)
GCCTGCTCCGCATCAACGATAGATAACCTCTCAATGTTAAAAGATGTATATTACCCAAATTCCAGTATTTCGGCAACTCAGATTGCCAACCTTTGCCCAT
TTTCAGGTCCATGCGCACGCACATGACCATCTTGTGGGGCACCCAGCTGGCCGAGTCGGCGCCCTCCCAGTCCTCCGACGAGCCCGAGGAGGACCTGGAC
GAGGCCTCCGAGCGAGACTCAGCGGCGGCGGCGCCGCTCTTGTTGTCATTGTCGTTGCTGCTGCTATTGGCGCTCTTGGCGTCGCCCAGCAGGTGCGTGG
ACACGAAATAGTGCGCCGCCGCGCCCAGCACGAAGGCGGCCGTGCACTTCCAAGCCACGTCCTCCATGTCGCTTTTTGTATGGAGCTGGTGATTCCCAGG
ATAATCGAAATGGAATGGTGTGTGCCACGTAGAATAGGGATTGACAACGAAGCGCACTTCAACTTACTGTGCGCTGTTACAGTATCGAGTTTTGCTAGTC
GACAGATACATTTTTTTTTTCTTATTTGCGCTTGGCTTCCTGCTCGGACACGCAGGCCTCAAAGTCCTCTGACGTCGTGTACCACTGCGTGGTGCAGAGC
CACTTGGACTGGCACTCGACGTCCTTGCACGATGACTGCAGATACGACTGCGCCTTGGAGTTGTAGTAGTACTGCTCCAGTAACACCGAGTCGGACGCTG
CGCGGTCCACAAACGCGTTAAGCTCCAACGTGCGCAACGAGCTCACACCATACTCGGTGCTGGCCTTGAAAAGCGGCTGCCAGTCGAGCTCCTGACTATC
AGACGAGATGTTGGTGCCATACACGGTGAAGTCCAGCAGCTCGTATGTGGTGGCGTCGAAGTCCCAAACCATGAAGGCCGGGTTGTTGTCGTAGATGGGC
GAGATGGCGGCGGACATGAACAGCGGTACGAGCTCCGACCCCTCGGCTTCATCTTGCGCGTGTTGTTCGGAAGAGAGGGGGACGCGGAACTCGATGCTGT
GCACGTGCGCGAAGAGCTGCGCCTTGATGATGTCGGCAAACTCGCTTACAATCGCCTTGTACATTGCGATGTACGTGGCCTCCCACATCTGAGCGCCGCT
GTACGAGTCGATGATGGGGGGAATGTGTCCGACAACGTACGCGAACTTGCCTGTGTTCCGAAGCTCGACAAGTGTATCGTTGAGCCAGGCAAACTGGCCG
AAGGGGTCCGACATGTTTGTTGTGTTCGGGATGTGGTTCGGCTGTGCGGCATGGTAGAAGAAGTAAGTCAGCGCAGAGCGTACAGAATAGTGGTCATGGC
GGTAACTTACCGAGTAGGGCACTGTATTGAGCGTCAAGACTACCAGCTTGTCGTCAAGGTCGTACGTCAGGTAGCCGCGGTGGTTGAACCAGTCCAGGTT
GGACTTGGACAGCGTGTCCTGCCACGCCGCCGATATCAGCGAGATCGACGGATTCACCTCCGTTTTCGGGTCCGTCACGTTCATGGTGTAATCGGGAGCT
GATGGTGTATGCAACAAAACTCATCAATGCATATACTTGTACTTTGGATACGCGAAATATGTGTACGTACATGTGTCAGCGTTGCCGATCAGAGTAGTGA
CGTCCAGGTTTGTGTCGCTGTCCGCGGTAGCGTAGTAGTGTGCCATGGTCTCGACGTTAGTCTCGACGGTCTCAGCAAGGAACTTATCGGTCAGATCGCC
GTGCACAACGTGGTCTCCGGTGTAGAGAAAGAAATCAGGATCGGGCATCAACTTCTTGGCGAATTCGAGCGCAGACGTCAGCAAAGCAATCGGGGCATCA
TCTCCATACTCGAACTGCATTTCCGCGGACTCGGTATCGTTCAGTGACTCAGAGATGTTCAGATGGACATCCGAGAAGTGCAATATGTGCTTGACGTTGA
GAGTGCTTGTCAAAGTTCGCGGGGAGATGCCGTGGGATCGAAGTCGGGCCGATGATACGAATTCAGCTCCAGAGAAGGCAATTGCCGCCAACAAAGTAAA
CATTGTTGTCTCGATAGTATGGTCACTTGGAGTTTGCTTGTGGTAGAAGAAATTGAAGTGACGTTGCCAATGATACTATTCAGTAATGTGGTTCATTTGC
CGTCGACCAGCCGAGTAAGGGAGTGGTGAGGCGGGtcacgataggaggcgaatttgagaatgagctatctggaggcgactcgcGAGTGGTAGCGGCGATG
CCATACCTAGGTACAGTTGTGGTTTCGAAACTCCTATCATCTATCCGGAAACCCGCATCCTCCCAATGTTCCCCACAGAGTTTACGTTGCAGCTGTGGCG
GGTTAATGGCAGTGACCACTCACCACCACCAGTGCTTACGCAGTCTGCAATCGACTTCAGCTTAGTAGATGGGCGTGTTGAAGGCGATCCAGCGGCCTTG
CATGTGTGAAATTGCCACGCTCCATGTCAAATGATGTGTTCGGGCTAACTTGTGATCCTCTCGCCGTCAGTCATTCGGCAGCCAGTCAAGGCTTGACTCA
AGCAGGGAGATTTAACATGATGTGCTGAGCCGATCGCGAGAACTCTGGGCTGGATTTCAGACTTGGAGTATCATCCAGAACTTGGGATCCTAGCATTGAG
AAGGTTTTGAAAACTAGGACCCCAGAGTCGCATGATATCGGGAAACCTGGTGCGCTCTATCCTACGTTCTCATGCTCCATGCAGACTCGTCTCCCGTAGT
GATCGTGGATCGAATCTCACAAGAATATGATTGTGATCGACTTCCATACACAAGGGAAGCAAATGCACTTGCCCCGTGCAACCTCTCGACAGGGAGTGCT
TCAAGCACGGCTGACCAAGCAAGCGTCAACGCGGATTGCCCGACGTTGACTCGTCAGATTGAAACGGTCTTGTCCATGCCAACGTATTGTGCATCAATTC
CTTTCCTGAGGCGGGCCAAAGCACTGCAGGCACAGTCAACGAAGCACTTCGCAAAGAGGCTAGCCTTGTGCACTCAGAAAAGCTGCCAGTCGGATTACAA
CAGCAACAAAAACAACACTATAACAATCTGCGTCTTACGACGCGGATAGCACTCGTGTATTTCAGTCTGTGTATGCTACGCTCGAGGACGGTCATTCCAT
GAAGCTGGTTGGGTACTGAAATCAGACGCAGGCATGTACACCACCACTTGAAAAAGGCATCTTCCACAGCAGCGCTCAGAGACGACTCGTATCCAGCTCG
TTGAACTGGCGAATCTCCAGCTTCTTGGCCAAAAGAGGTGCCATGTAGGCCCCAAAGGTAGCGTAGAACGGGTTGGCCACGTGGACCTTCAGGCTCTGCT
CCAATTCGTGGGCCAACAACGCGAATCATGTCAGTACCGGAATCGTAAATCTGTGCTGAGCAAAGGGCACTGCAACGTACACTCCTTTTCTCGTAGCGCT
CGACGATAGTCCACTTTCGTGAGTCCTGGTGGTCTTGCATCACGTGCCAGTTGAGAACCCCCGCGTCCTTCATGTACACGTTCGAAGCCTCAACGAGCTT
GCTACGGATTTTCTCCTCGACATCCTTCCCCTCTTTGGCGTACAGGTGGCAGACGATCGTGTAGACCATGCCGTAGACTTGTCTCCTTGTTTAGTAACTG
GGCAGCTTGAAGAATGACGTGGGAAGTCGAGCAGAGCTTGGCAAGAGCAGTTGAAGATGGTGCACAAAATGTTTACGACGACACTTTTGCTTCAACATCA
CGGATTGGGGCACGACACTAGTACTAGCCCTTGTAGTGCTAGCGTAATTCTAGCACTACATGAGCCTTGTTGCAATACGCACGGCGTTGCTTTCTTATCA
AAAGGTCGGTGACATTGAATTTAGTGTCGTGCGGTGTTCAGAATCATTGCGGTCCTTAACACGGCAATTGGAGCTCAGTGGTGGGGATACGTGAGACGGT
ATCAGTGTTCCCTGTCCTAATAGTGTTTATTCCACATGCACGGGCTTGCTCGTGTCCAGCTCGTTGAACTGGAAGATCTCCAATGGCTGGTCCAGAAGTT
CCGTCATGTAAGCACCGAACTCAGCGTAGTACGGGTTCGCCTGGTGGATCTTCAGGCTCTGCTCCAACAGCAACAACGATCAATGATTCAGTTAGCGTGC
GGTGTGAACGACAGCAATATATCAGGATCCAACACGCAGCGTACACTCTCGCGCTCGTAGCGCTCGACAATAGTCCACTTGCGGGGGTCGACGTGGTCCT
GCATGACATGCCACCCGACGACCTCGGCGTCCTTCATGTACGTCTGCGAAGCCTGGATGAGCTTGTTGTGGATCTTCCCTTCGACGTCCTTGCCTTCCTT
GGCGTGGAGGTGGACAACGAGCGTGTAGACCATCTTGGTTAAGCTTCGGGTGGTGGTTGTTCGTGCTTGGCAAACTGGCAGCGAATTGCAGAATGGCGAG
GGAGGACTGTCGTTGAGTGAAGATGGCGCATGCAATTTGTGTTTACACATCAGTGGTGATGTAGACGACCTGGCTTATGTATCATTGCGACGAACACCGG
CAACGGAGAGCTAGGCTTTGAAATAAGCTATTCTTTTTGTTTGGGCGCAGACTCCTGTAACTCTGGGGAAGTCGGATACGAAGCACCGAAAATGATCATG
AAAATAGTTCCGTCTTTGTGTTACTCAAGGTTTCTACATGATAGAGACATCCAGCTTTAGCCCACGACGACAAGCCTCAGCGACACAATGCCATGATCTG
TCATCGCTTCGGCCATCGGCGCACCGTACAACTTGTCATGCCATCGCTCGCGTGGAATACACTAACAGACAGCAAGCATCTACAGCTCCTGGAACTGGTG
CACGTCCAGACTCTCCTGACCGTTCTCCAGCAGCGCCACCAACGCGCCCGCGAACGTCTTGTAGTCGGGGTGCTCGCGGTGCTTCGCCACGCTCTGTTCA
CCAGTGTCACCGCATTTCACGAGGCGCATAAAAGCAACAAGGTTAGTCCCAAGACACACACCCCAAACAAAGCAAGATAAAACGGGTAGACCGTGTACGC
ACGCTCTCCTGGTCGTAGCGCTCGACGATGGTCCACTTGCGCGGGTCGCTGGTGTTCTGCATGGGGTGCCAGCCGATGACGCTGACATCCTTGGAGTATG
TCTGCGAGGCGTCGGCCAACTTGGCGCGCAGCTGCTCCTCGACGTCCTTGCCGTCCTTGGCGTACAGGTTGACAACAATCGTGAAGACCATGTTTTCTGG
AGTGAGGGAGGTGGGGGAGGGTGATGGGTGGGTGTTGTTTGGGGGTTCGAGAGTAAATTCGAAAGTGAGCGAGACGGTGGGTTGGATGAAGTCGAGCTGA
GGCTGCTAGCTCAGTAGCTTAGCAGTCTGAGGCTGAGGTGCGATGGGATCCTCGGCCTAGAAGCAGTGTGGCGATGTGGGCGTCCCATGCCGCCTTGgac
acgtacgtcacttcaatctggcacgttgataccgtttacgctaggcacgttgtgggggattatcggtaatccttTTTCCGTCTGCGATCGACGAGATGCG
TGCGTGCGAACACGCACATTGTCGAGTCTGATAAAAAAAAGTAGGTTGATCTTCTTCTACTAaaaagtacccagcagacgttttagctgtcggttaatga
aaacaatggctctttgttcttcaaaacacgatatccacgactgcggcatctgctgcaggattACCGTGCTTTGCaagacactgatttttcagcaaacatg
acagtaaatgcactcgcggaacctaagtacccattctcgcgaaacgaaggtggcatctcgaaggggtttcgtgttcccagctagctctgagtgagatggt
gacgttagttagtttcatattgcttccaaatcgatGTACCTGGCGCGGGAGGAAGGCTCTAAATGTTGTCAATCGCGAAAAAAAACAAGATATCCCTtga
ccagtatcaataatgaccaaacagctacgaggcaaccacacgacccacagattttgaagctacaaaataacaactcgtgctactatcaatggcaccatct
gactgtagtgcagatctcgagggattaccgataatcccccacaacgtgcctagcgtaaacggtatcagcgcgccagattaaagtgacgtacgtgtcCAAG
GCGGCATGGGACGCCCACATCGCCACACTGCTTCTAGGCCGAGGATCCCATCGCACCTCAGCCTCAGACTGCTAAGCTACTGAGCTAGCAGCCTCAGCTC
GACTTCATCCAACCCGCCGTCTCGCTCACTTTCGAATTTACTCTCGAACCCCCAAACAACACCCACCCACCACCCTCCCCCACCTCCCTCACTCCAGAAA
ACATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAGTCGAAG
GTCTGCGATGAGGCTGATTACGTCGTGTGCGACACACCAACTGGAGCCATGATGAGGTAGACGCCGAATAGATCGACGTCGACGAGCACTCGGCAACCAC
TCGTCAGCGAAGTGCTGCTGGTCTTGCAGTGTGTAGTGGAGCGAGTGTAGGTAGGTTCGTTGTTACAGTACATGTATTTACTGAGCTTGGCTCGAAACTT
GGGGCGGTCAGTCGCTTTGAGACTTTGAGGTCGAGTCGCCTGTCGATGGCGAACTCGACGCGTTTCCTGAAGTCTTCAAGTTTAAAGACTACCTGTATTC
AGACTCACTGCAATACCGGTACATGTATTATATCACGAAGTATCGAGGCCGTTGCGGAGGGTTCCAACAGTGCTGTGCCTGGGATGTCTCTGAATACAGC
TCAAGGGCTTGCAGCAATTGGGA