Description :
From Genome Similarity Track
Location :
Scaffold_492:2087- 3090
Transcript NameFunction/comments
g17843.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
CATCAGTGGAGCCACTGCATTCGTCGCTGGCGGAGCTGACAGACTCTCAATCAAACTTCTCGGACGTTGGGCCTCCAACCGCTACGAAGAGTATCCTCGA
CAACCAGCGAAGGCGTCAACAGGGCTCTCAACACGAATGGAGCAACGCAAGAGAGTCAAACACACGACCAACAAATTAATATCATCATGGGGCCGTTCAC
CGCGCCCCGTCGACTCATTGCAATGCGCATCCTGTTTGCCCCAAATCCGGTTGCGTGATGGAAATTAGCCAAGCGACTTTGAAGACAACAAGTTTCTCTT
TGACTGCGCTCCGGCGGTCCAGCCATGCTGGGGTCTAAAACCCAAGCTGAACCTTGCTGGTGGGGGCGGCGATACGCACACCAGTCCATTGCTGCGGCTA
CTTCTATACGAGCCGTTAATTGCTGTTCATGCTCAAACATGTCAGTTGCCTTGTATCTTACCATGACACAGAGCCGCAGCCAACAAACCAAACCTCATGT
CCCTGCGCGCCGACACCTTGTGGCGAGGCAGTCCAGCCCCTTCAATCCTCGCTGCGGTCGTTTGTTCAGGCGACACTGGATGTAACGGGGTTACCTGAAG
AGTGCCCGTCACTCTTCCGAGTTGGGTACGTGGTGTACCCAACACCACTGACACGTGGTGGTGGCTCACAGCCACCCATACATAAAACATATAAGATAAA
CTATAGTTGACTTAGGAATTGTATTGCAAGACGATCTCTAGGTAACTAACTATAAATATATCAGTCTATAAACTACGTTGCCTAAGTCAACCGTTCCGCA
AGACCGGGAACTAGTGAACCGTCGTTCACTTGGAGTTTGTATACTCCTAGCACTTCCTCGAGCGCAAGGTGCTGTGTGACTCCCGTCACACTTGGTAGCA
CTTGTAGTCAATCCTCGCCTACGCGGGTAAGATTGGACTACCTGAATCCTCTGTGGTCTCAAGCATTGAGCCACCATGGATCGCAGTGAGTTTCCTCACT
TGA