Description :
From Genome Similarity Track
Location :
Scaffold_1:2086020- 2089718
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00546hypothetical protein
Phypa_INRA-310PPTG_00547hypothetical protein

Sequence
3698 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTAATACGCAAATATTCAGAGCTTCTCCGGGCACGGCACGGCATTAGTCTTAGTT
TTGATTGTAATGGCTCATTTCTTAGCCCTTTTAGGTGGAGAAAACGAACTTACGTGTTCCGTTGCACGCTGGATTGCTACAGCGTATGCACACCAATACT
CGCGATGTAATGGGCGTGAAAAAGTCACTAACCAAGTCACCAGTCACATGCCAATTTCATTAATTATTTCTTTCTTTAAATATATTCATAATTTATTGCT
ATACTAAAACGACATCTTCGACTTCGCGTCAAGCAAGCGTTCATAAATTCAACAGGATTCGCGAAGCCCATCTTAACTTTCTCAAGTTGCAAGGCTTTTT
CTCATTGCATCCCCTCCTCGTGATATGGACGATTGATTCAGTATTTTCGATTATTTTCTTAATGGTATGAATGACATGACCTATGCGTTTTTGTGTTGTA
TGGTGTTCGATTCTACATCCGCTCGTGGCCGGTTTGGTTTTTGTGGTGCATATTGTTTGCGTGTAATGGATTATTTCAATATGACAGGTAATTCTCTGGA
TATTTATATCCAGAGTCCAGAGTTTAGGTGGGATCGAGACCCCTCGTGGATCCTATGTAAACGAATAATCGGATACTTGTGTAACCACGTCAATTTTACT
TACTTACTAAGAGTAAGATTAACTGACGAGATACTGGATGATATCTGATATTCTATGCGGAAGAGGGTGAATGTTGATCCAACCGGTGAAGAACGACATT
CGTGCAACTTGTAACTAGAGCAACAATCGTGCAACACTGTAGCGACATTGCTTGGTTTCAGGTGGTGTGCCAGTTTAAGTCAAAAATAGACTTGGTTGGA
GTATGGATAGATACTGTTTATGTGCGGTCTTGCAAGTACACTTAAATTTCTGTAAATTCTGATTTACACTCTGTAAAATGAGAGTATTGTGAAGGATCAA
AGTATGGGGTATATTAACTAAAAGGGTAAAGTACCTAGAAGTTCGCAATAAACAAAACCGGATCTTTGTGGCTGCTCTGTGTCGTCGGTATCTCTGCTTG
CTGCTCTTCCTGGTCGAGGACATGCTCCTGTCCCTGTTCCTGCTCTTGGTGGATATCCTGTTCTTGCTTGCACTCCTGCTCCTGACGCTGATCTCGTATT
GTTTTTGTAGGTCTTTTACTCTTTGCTAGTTTTCGGGTTCGGTTCGGAGTCTTGCTTGAGAAGGCTTGTTGTAGCATCTCGCGAGTTAACAACCTACCAG
CTACTGTCTTAGTTTTCCTCTCTTTCCCTGCTTGTGTTGACGAGCAGGTAGAAGTAGTATATCGTGCTGCACTGTCTCCTTGTAGTGCAACCGCGCGGCT
TCTTTACAGACGTGGGGACGCCGTTATCTTGACAGTTGTGTATTTTTTCGTGCATTTTTACGAGGTTTAATGGAAAAAATTCCGCAGTTCCGAAAGCCTG
AGGAAATGTTGATGTTGAAGTTGCAACTTGTCCATGCAAGAGTTGCCACTTTGAGAGCTTTTTCGTTGCTGATCACATTAAAACCATTGGAACAAATGAC
AGCGTCGATGAGATGGTGGAGTGTGTTTTTAAACGAAGAGAACACTATAACGTCCAATGGTTGTAGTAGGTGAGTGCGGTTGCGGGAAAGCAAACCAGTT
TGACAAGCATCCGGTCGGTGGTCCCGACGATTCCATCGGCAATGCGGGATGCGCAGCCATCCATGACGAGGAGTAGTGGTCGTTTGACTGGTGTAGGAAC
AGCAAATGCGAAAAACAAAGATCCATTAGCAAATAGAGTCGCTGTCATAAACGCCTTGTTGTAGTTGTAACTGCAGCTCCAGGTATACTACATTGTTCAA
GAACTTCATTTTCCACTGGTTCACAAGGTAGAACAAATAAAGGAGGTACGACAAAGCCTCCATCGCTACTGCACGCTACAATAGAGAGAAGAAAGCGTGT
AGTAGGATCAGTGTGCCAAACATTTTTGACCCTTCACGAGCTACCACGCGTGTTGTTTTGCGGGAACTCTCGAGTGCAGTTTCATCAACGTTGAACACGC
GAGTCGCGTCCATGTTCTCTTCCACGATAACCTTAGCCAAAGACCCGAAAAAGTAGCCACTTCCATTTTTGTCACGTAATTGCGCACCTTCGACACCGAC
TTAGAGACCCGATAGCTTACGTCAGGAAAGCGAGTTTTGAACCGTCGATACCAACCCTCACCTACTGGTTGATGAATAACCATCTTTGAAAATGTGGCTG
GCTTTTCTGACGATGTCCTTCCTTCCAACAGGAGCTCCTTTAACCTGCTGACTCACGACCCAATCGTGAATACTGGTTTCAGATTCCTTTGGCAGAGCGG
TGTCAGGGCCGCACCGTTTGCTGAAGGTGTAAGGGGCCTTCATTCCCCTCTTCGTGCCATTTTGTGTCTTCTCCAACCCATCGGAACAAGTTGCGGGCAG
GAACACCGTTCTTCTCGCTGATATCGTCGATATCGCCCCCTTCTCGGATAGACTTCACGAAGGCCATCTTCGATTTTTTGCTGTACGTGCGACACTTCAT
ATTTGGCAGCTTAGATCAAAACTGAGAGGTATAAGTGGAAAGGCGTACGTGTCTATATATAACCAATCAAATGCAGATTCAACTGCTATTGGCGCGCCTT
AATCTGGCCCATTGACTTAAACTGTCCATTTACCTTAGACGTCGTAGCTGTTGTCTCTGTACCCACAGACGTCGTATCAGAAGCCATTTTCCCCCCGGCA
TCATAGCCTTAGTAATCGAGCGCCAGTCGTCATATCCGTCGCTGCCATAGCCAGAACCATTTTTACCGAAGTGGGCTTATCCCGTACTCGTTTCGTCGTC
GTATTCGTAGCGTAGCCGATGTAGCCAGAACGCAGGCCCTCGTGCTGTAGTGGTCGTACCCGTCGAGGCGAGGGTCACCTTGCTTCGCAGTGATCGTTAC
GCGCACGGTGGAGTCGTTGAGTGTGCGCGCCGGACTGCAAATTCGCTCACGGTGGAGTCGTTGAGTGTGCGCAAACTGCAAGCAAAACTAAATTGTCCGG
AAAACAGGATAATAGTAGCCATTATAACTCTTATTTCAGGATGGGCATCCAGTAAAATCCGACTTGTGACTCTTACGTTTCATACAATTTTCGTGATGAT
TGAGCAGGATCGAGAATAGCTCGGAATTTGACCAAGAAGCGCCGCTTGGCACCGTTATAAAGAGCGGATCAATGCTTTTACACGCAAACCCATCTAGTTG
TTGCGCCTTTAAAAACAAAAACACATATGTCCTTATATCGCTTGACAGGTTTGTGGCGTATAAGAAACACAAATAGCTGGCAAAGAACACCGTTTTCG