Description :
From Genome Similarity Track
Location :
Scaffold_1013:2086- 4420
Transcript NameFunction/comments
Phyke_g11815reverse transcriptase

Sequence
2334 bases(100 bases per row)
ACCGNNNNNNNNNNCGATGAACAACCTGATGAAGAACCGCCGGGAACACTCTTAGATCGACCTCAGTATGCTATACCGAAGGAGATCCTGACTCGCCCGA
TCGAATCACCGAAGCCAGTAATGACTCCTGTGGCCATGGTGTCATCGACTCAAGTGATGAACCAGGACGTTCCGGATCTGAAGCGGGAAACACAGGCAAC
TGCTGGACAATCGAGAGTTAAGTTCGTGGATCAGAAGGATGTGGTCTCAAGTCAAACCGCGACGTCATCCGAAGTCGAAGAGATCGAAGAGGACCAAGTG
TGCTTCCATGAAGGCGGTGACTTATTCGCCGAAGATGTCGAGAGGCAGATGGGCGTTCTACCTGAAGTGGTGACTACTACCGAGAAGGTTACGATCGAGG
ACATCCAGGTTGGCGATCCTGATCGCAATACTCCAGAGGAGATCGACCGTTTGCGACAGATTATctggcgacgacagcacctACTGATTGGAAAAGGAAA
CGCTCTTCCTCTAGCTGCACTTGGTGCAATCTGTGACATCGATGTAGGCGGAGCAGCCCCAATCGCACAACGTGTGAGACGAGTTGCCCCGCAGTATCGG
GAGAAGCTATCTGACCTCATCAAAGGTTTGTTATCAGCAAGGATCGTCACTCCGTCGACATCTCCGTGGGCGTCACCGATCGTGGTCATCATCAAGAAAA
ACGGAGTTGACATTCGCCTGTGCATTGATTACCGGTTGGTGAACAGCTTGACGCGCTTGATGGTGTACCCTATGCCGCTGATCAGTGATCTCCTGGAAGA
TCTGGATAAGGCCTTGTGGTATTGCTCACTTGACATGGCTAGTGGATTCTGGGTGGTTCCCATGACGGAGAGAGCGCGGAAGATCTCTGCGTTTATCACT
CTTTTTGGGCTGTTCGAATGGTCACGTATGCCGTTTGGATTGAAGAATGCTCCACAGATCTACCAGAGGCTCATGGACAACGCTCTATACGGATATCTCC
GGATTGGCGCTGATCAAGGACTCGCTAAGTCAGTCGATGTGTTTGAAGCCGGTGAACCAGAGCCAGATCTGACGCCATCAGTGTTGGGAAGACGATCGTA
TATCGACGACATTCTGGTTACTGCTACGTCTTGGGACGCCTTGTGCGAGAAAGTCGAGAAATTGCTGGACGCTTGCGATCGGTGGAATTTGTCGATCAGC
GTGGTCAAGAGTTTTTGGGGCCGCCGTAAAGTCGGCTACCTTGGTCATCAGGTGTCGATATGTGGACTAGAGGCGAATCCGAAAGATCTGGAATCATTGG
CTAATCTCCCTTTTCCGAAAACGTTGCGATCGATGCAGTCCTTCTTAAGGAGCTTGAACTATTACAGCCGCTTCATTGAAGACTTTGCGATCTACGCCGC
GATCTTGTATGAACTGCGTGAATCGGATTTCCATGAGATCAACTGCTGGAGAGAGGATAACGTCGAGAAACCGGAGGCTGGGGGTGACGTGCAACCGTCG
GAAGACGATGGACGTCAAACGAGAGCAACTGTGGCCTTCACGATGCTGAAAGCCAAGATTGTATCTACCCCGATCTTACGTCACTTCGACTGTGACCGAA
CGTCAGTGATTGTGGTCTACGCGAGTAAGTGGGCGATTTCTGCAGCCTTGATGCAAGAGCATGACGATGTATATTGGCCAGTGACCTTCACCAGCCGTAC
CTTGAAACCCAACGAGATCAACTATGGCATCGTGGAAAAAGAGGTATTGGCACTCTTGCGAATCCTGGACGTCTGTTATACCTTGTTGGTAACGAGGTCG
ATCAAAGTGTTGACACGATACTCGACACTGGCTTGGTTGGTGCAGTCATCAGGTTTCCAAGGAAGACTAGGTCGGTGGGCAGCGCTGCTATCTCCATGGA
CGCTCGAGATCATGAAGTGTACGAAAGGCGAAGACGAAATCCTGGGTATGGTTGCTGCAAGCACCACACCCCGTGCTGAAGTCGACGAAGTCCTAATCTC
GATCGCGCCCAAGAAGCAACCCCGTCAGACTATCTCCATGCCGCCACCTACAGTCGAGGCAGGTGAAAGCTTGTTGGTAGCTAGTTTTGATGGATCTGCT
CGTGTGAAGCGGGGTGGTGGAGCCTGCGGTGCTGTTGTTTGGAAGTTACCAGGTTGGACGATTGTCACTGCTGTTTCGGAATACTTGGCCGATCTAACTG
TTAACGAAGCCGAATATCAAGGTCTGTTGTTGTGCCTCCGACTCTTGGCCAATATGGACAAGGGGCGGCTGGTACTCTGCGGGGATTCCAATTTAGTGAT
CCGCCAGATGCGCGGTGAGATCGAGTGTAAAGCA