Description :
From Genome Similarity Track
Location :
Scaffold_330:20854- 23975
Sequence
3121 bases(100 bases per row)
AATACGCACCTCTTCTGGTAGACATATTGTTCCGTCGGCTAGATCCAGACTAATGCCCGCCATAACCATAAAATCCATACCCAATATGGCCTCTTGGCCG
ACTTGATCACCGACCCAAACGTCGAAATAATACACCAACGATCCGTCCAATGTGATCTTGATCTTCGTCCGCCCGACCGTCATATATGCATTTTCTCCAA
TTACGACGCACTATTGTGTTTGACTTTCGTCGACCACACATCCTACCTTACGAGCAAAGGTAGGATCGAGGATCGACACTTCCGCGACAGAGTCGAACAG
CATAGTGGCTTTCTCGTTGTTGATCTTGCCCGTCGCTTTTGCTTGTTTGAACCATTTCCGGGAGTATAGTGTTTCCAATACCCGCGCGATTTCCCTGGTG
CGAGGTCGAGCTCCATTCTCACAGGCGATCGGGCTTAATCATTCACTCTTTTCACAGTTGCTATTGACGAGACCAATGAAGAATCATTATGTATACTAGC
TATCGGATCGATTCGGTCGTTAATCTCTTCATTCTTTCGTTGTCCTTCAATAAATGTGTAAATGCAAAGCCTAGAACGCTCGGCTCGTGTCAGATTCCAA
CCTGGCGAGCGTCCTAGTTTAATATCTCCTCCTTGAGGGAGAAATTCCAGCATGCTTCGTGGGCACGTACCACTTTTGGATAGAGTTGTAAATTCTTCCA
TGGGGTATTTGCCACTCTCGTGTATCTTTCCGCATGCTGCACACACGAAGACACATTATTCAAAGGGATATCCTTTGCGACCACAATCATGGAACGTCAA
TCTCTTCCACCACCCTTGATCATCGTGTCTGGTAGATCCACAATGGGTAAACGCCTTCGATCGCCCACCACGATCATGCCCATCCCTTTCACCATAGTTC
TTCTGCCAGGTGTGGTAATCCTTGTCCGATTCTTGTGGTCACGTGTAGTAGTCACGCAAACCCGACGACGATCCACATTCTCATCGGATCTAAATTAATC
CGATTCCAATCCGCTGGTTTCGATTCTCTCGCGGATCGCTCGCACCGCCCGGGATGTCTTCAACGACATCAGATTTGAGAACTTGGTCTTTCGCTAATGG
ATTTGGTTCGATCCCATCGGCGATTTCATCTGGCGATGCATCATCCGTTAGGACGCACGCGGAGATTTCACCACCTCGTCAGCATCCATCAATCGCAGTA
GTGTCAGCTGTTTTATTAAATCATGATCGTCCAGCGTAGCAATGAAGTGCTCCACACGTTCGAGACGTGTGGCCGAGGTAGCTAATATTTCTACTTTGAT
CGCGATCTTGGCGTGCTTTCCTGCAACATCGAGGCGATACAGCTATTCCAGCGGGGTTTTATCTGATCCGTTCCGTGCGAGGTACTATTGCCTAGCCACA
GACACCCCTTGCCCTCTATACTGAATACTGAAACAATCCAGAAATCGCTTCCAGTTGTACCGAGTAGATCGACATAATTGATTGTACCAGTTTCGAGCTG
GACCTATCAACAGATCACCGAACACCAAACACTTTCCTTCGTCCGGTGCCTGATCGCGCAGAAACTTAAACTAGACCTTGCTAATTCAGCTTCTGGCCTT
AACCTTCATCTCTGTCTTTGCCACAGAATTCTTTCAGCTCCGTCGTCGCTGACACACGAATACGTTGAGAAATTCGGCCACTATTCTGCGACGTTTCTAC
AGTGGCCACCATCGCACTTCTCCGATCTTCTTGACCAAAATCATCGGGATCGACGTCTTTAGGGTAAAAAAAGTCCGATTGACTGCGATGCGATCGGACC
GATTCCATCACGACATCTGGGGTGTATGCTTCTTTATATCTCGTAGTCTTGATCCTTTGGCTTGGTAGATCGCTTGATACGCTTGTTCTAATTTTTCTTG
ATGAAAAGGTTTCATGGCTTCATAGAGGTACGCCTGCAGGTGTCCTTGCGTAGTCGAGTCCATCTCTCATTCAGCACGTGCGGTCGTTGATCGTGGTTCG
ATCTTGATCGTTTCAACCCGATCGCGAAGATTTGCCTCCCCACTTGGGTCTAAAGACATCCGCTGATACCGATCGAATGATCCAGGTCGATTTCAGATTG
AGCTGAGACGTACTGCGAAGATTTGGTGAGGTATCCTCTCGGGGTGCTAGTGATCGCTGTGTCCGCTTGGTCCGTAGGATCGCACTTACCCGTCAGGGGA
ATTAACTGTCATATAGCGATCGATACGCGTGGGTCACCTGATCTTGCCCGCACTCCAGTAGTTGCTCACGTCGAACAATCCTGCGACAAAAGCAGCGTCA
TGTAACAACCGTATAATACCGTTGATTTCGTCCAGGGTATTAGACGCTACTGCCGGCGGGGGTTTCGGACCTTAAATCCCTCCGATCAGCTTGGGCTTCA
GAATATGGAGTAATGAGTCGATTGATAACAAATTATTGATTGTCATCTTGTTGAAATCCCTTCGCCAACTGATCCAGCTGCCAGCTTTTATTTTCACATT
TTCGTACACGAAATTGATCGGTCGATTGATCAATTTCAAGCTGCGATCGTTCTGATCTGATCTGGGCGCCTCTTTCTTCACTCGTGCTGGCTTCACGTTC
TTCTTCTTGGACTTTCCTTGAGTAGTCTTGGGTGATAACTGTTTGGTCTTATCAGAAGGGTTTTACACAGCAAATAGTGCTTTACGGCACGATCCGCTAT
GGTCCCCGAAGAGACATCAGGAGAGGTCGATGTTTCTCTTCCAAATCTATTCATCGATCTTCCTCTTTGATTTTCTTGTCATCAGAGCCTCTCCCAAAAC
TCCGATAATCTGAGGATCCATTAAAATCACGCGTCTGCGGCTATCTCTCTGCCTCTGACGCTTCCACCATAGGTTGGTCTTTATTTTCACTTCTCCACTC
CGGAACTTACGGTGAAATTCGTGGTTCAATTCCGGGCACGCGCACCATTATGGTGGAGAGGCGATCACTCAATTTTTTGAGCCGACCCCGACTCTCCACT
GGTGCCCAGATGACCGAATATAGGAGGTGGTACTTTTTTTTGTGCCTTGTATTTCCTTCCTCACCTTGTGTACCCGTCGGTAGGGAGGACTGCAACCTTC
TCGGTGGACTCGTGTCAAGGG