Description :
From Genome Similarity Track
Location :
Scaffold_63:208523- 218160
Transcript NameFunction/comments
Phypa_INRA-310PPTG_17109hypothetical protein

Sequence
9637 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGGTACGTAATGGTATAGA
CAGTCCTCAGCGTACTATCTACGTGCGGTGAAAAAAAATGGCTATGAAACCAGTATCTGTCAACTACTCACCATGACGTTGTTTTCGCAGCTGAATCAAG
CGCGAAACGAGATGAATCGGAAGTCGAAGAAGGTCCTCGGAAGGGAGATGATGACGGAGACGATGATGTGCGTGCAAGTTTTGGCGCATCTTCCCTGTCG
GATATGGGCATCATCGATCGAGTTGACGAAGGCATCATTCACGGCAGAAAAGGTGGAGATCGCCCTGAATAAGCTGTTCGGTGACAAGTCCAAGAAAGCG
ATTGTCGGTCAGAATGAACCGGGTTCGGTGACCTGCATCAATTATGTGAAGAAGGGAACCAAGAAGCGTAAGTCGCATGTCAACCCTGTGTTCAAGGTCA
AGGGTGTTTTTACTGCTTCAGCGAAGGGCATCAGAAGGCCTAGTGCGAGTGCATGAAGACGGATCGGGACCCAACTCGCGAAGGTGGATCAATCTTTAGG
ACCAACATTCAGGCTCAACCGTCGAAAAGGACGCCAAGCACCGTCAAAAAGATTGTCACGGTTCAGTATGTGGTCAAGAAGCAAAAGCCAACCCACGAAC
CACCAACGGATGTCGAAATGGATGATGAATTCAAGATGTCAGAGACCGATAAAAGTGACTCGGAAATGGACAACGGGGAATGTCTTTTGACTTTCGGACA
AGTGGACCCAATGGTACGTAAGAAATATGGTTCATATTTAAGTTGGTTACGTCAACTAACAGTTTCGGACGATCTGTGGATTGTTGATACAGGAGCTGGG
TGCGGCATAAGCTCGGACAAAAGCTGGTTCGAAAGCTTACACTAGGTACCAGCCACAGATTTGAGTATGGTAATGGTAGCACGTCAGAGACTACCTTAAC
TGGTTCAATACAAATGCATGTTGCAACCCCAACTCATAAGTCATTACGCTTGAAAATAAGAAGCATTGCTTTTGACCGTCAATGCGGGAGTAATTTAATT
AGCGCACGCTATTTGGCTTAGCAAGGGTATAATCACGTGCAATCTCGGGATGGGGAATTTCTGTACTTTTTCAGTGATAATAGTCAGCTTCTATTTGCAG
CAGTACAAAAGAGAGCGGTGTATTATTTGCCTTCATCTAAGCATAGTAAGGTCAATACAGTGAGCAAGATATATTCTACAGAACAGAGAATTGCCTTAAT
GGAAAAGCGGCACCTCAGATTAGGTCATATACACAAGGCCAGACTAATGGCAATCTTTGCTCATCAATTGGTGAGTGGAATACCTCGGATACCACAATCT
GATCTTAAAATCTTCCATTTTTTGCACTATATGTGAGGTTGCGAATTCTACTAGAATGTCGTACCGCAATAAAATTGGGTCACGCGTTAAACAGCCATTG
CATACCTTGCACATGGACACTATGGGAAAGATGAAAGTGGATGAAACGTATGGAGGAACTGGATATCACTATACGTTAACGATTGTAGACGATGCTACAT
CTTATAAGTGGATTTACGTGATGAAATCAACAAAAGAAGTGTACACACATGTTGTAAATTTGGTTTTGCTACTCAGAAAGCAGTTTAATCAATACACAGT
GAAAAGAATTAGAAGTGATGGCGGTACTGAACTCGTTAATCAGAAAATGAAAACGTTTTTTCGGTCAAGAGGAATACTATTTGAGAAATCAAATGTAGAA
AGTCAGGAAGAGAACGGTAGTGATGAGAGATGTCATCAAACACTGATGAGACAAGTTAGAAGTTCGCTTTTAACAGCAGCCATGCGAGCCCGCTGGTGAC
CAGAAGCGAATAAATATGCGGCGGAAGTGTCGAATAGTTTGCCGACGTCTAGACTTGGCAACAGCTCACCATATGAGGCACTTCATGGTAAGAAATCTGA
CGGTAATATTCTTCAGATATGGGGCAGTACATGCTATGTCCATATACCTAGTACAAGGCGAACAGATAAAAAAAACTAGGGTCAAGAGGTCTAGAATGCA
AATTTCTTGGTATTTCGGAAGACAATAATGGCTGTCGTCTGCTGGATACAGTCAACAAAATGCCTTTGGTGTCACGTAGTATACGGTTTGACACGACCGA
TCAGTTAGCAGCGATAAGCAGGCTTTTCCCCAACGAAATCACCAACTCACTACTGCTGAGACAGAAGCTATAATGGTCTGTACAGGTAGTCTGTTCCACA
ATGTCAATAGCACTATTCGCAGACTTCCACATGTGGGAGATAGTGTAGCTGTGGGAGCTGAGTACGACCAAATACGGCCTGGTGAGTCACCGATCAGTCA
GGATGACATACAATTGCGCAGAGCCATGGAAGGGCCACCACAGGTACCTATTTCAGATAGAGTTAGAAAAGACGAAGACTTTGTTGATATACGACCGCGC
TCGCAGCGCAAAAGGCAGCGAAGTACGCGGTTAAGCGGGTATGAAGTCACTATTAATTCGGTGCTAGGTGTTAGAGCTAGCATAACCCGCATCCCAATTC
GGGATTCACTAAAGAAGGCGATAGCACGGCCATATCAGGAATCTTGGTTGGGTGTACTCGAGACTGAATACCAGGCACTAATGGCCAATAAGATATGGAA
AATGGTAGATTTACCAAAAGGAAGGAATGCATTAAGGTGTCATTGGGTATTAGATGTGAAATACCATGCCGATGGATCTGTGGATCGGTTCAAGGCAAGA
CTAGTTGTAAGAGGGAATCATTAATAGTACGGGATTGATTACGGTGAAATATTCTCATCCTTTGCCCGATATGAGTCTTTGCAATTAGTTCTAGCAATTG
CAACAATTGAAAATTACCACATCTACCAAATGGATGTCTCCACAGCGTTCCTGAATGGATATTTATCGGAGGAAATCTATTCCACCAGTGTACTGTGGTG
TAGTGATTTCCAAGTAATCGCTGAAGTGGCTACATTCAAGTTGCTCAAGCTCCGAACTCTCGGTCATGCGACAGGTGGTGACCACGGCGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCACGTCCA
AGTCCGACACAGAGTATCTCAAGACAACTAAAACGTATCCATCCGAATATGCCGGTCACGGAGTAAATGGTCCTTCATTTGGTCCGGCTTACGTTGGCGG
GTCGAGCACGTCGCTCCGGTTCCAATACGAGACTTCCTGGACCTCACCGGTTTTGGTATTCGCCGAGTTGGACGGCGACTACCAGGAATTGATCATGTGG
GAACAGCTCACGGATGCAGCTCGTGCAGCTTTGAACAGCAGCGATAACTTTGGAAGGGCTGAGGTTCCGTTCAGTGATGAAAAATCGAAGACCATCTCGA
TGAGGCGTGGCCGTTTTAGATTTAAAGCGACTGTAAAACATGTATGCTGACGGATTCTTATTGAACTAATCGATTTGGTTCAAATAGGTCAACATGCTAC
TGCAGTGACTGGATACCAAAGACAAAGCAATGCTTTTTATCGGCGTTAGATTGTCAAAGCTAATGGTGAGAAAAGTAATTCTGCATGCTGCACTATATGA
CCAATGATGTATATGACATCTTCGCTTGGAAATGCTCATTTAAGTCGCTGGCAGCGACCTGTTGACATATACTACAGCCCCTGATTCGGCGCATTGTGCC
ACATACGCCCTTTAGTGTCTTCGGGTGCTCATCAAGCCAGCGCTGCGGGACTACAGAACACAGTTATTCGTCAGATTGCTTGCTCCTTAGACTGGGAATA
GCTTTTTCTTTTTGCTATTTAGTATTCAAAACGCATAGTACGTACTGTCGAGGCCTTTCGAACAGGGCTACACTACAATGAGCATTCATGGATCACCATG
AAATATCACTATTGGCTGTTAAGTTTGTGAATCTCAATACAAGCTACAAGTGGTAGAAGATGAAGTCCTCCGTTTACATCATTTGCCGACTCAGGATACC
TGATAATATCCCACTGCGATCGTTAGCTACGAGTTTATCGAGATGGTTGGAAAGTATACCATATTCTATTCGAAGTGAATTAATTAAGGTTATCCGTTCG
AATCTCTTAATCTGTTGTGGTTAGGGGAGAGCAGGACTGATTACTTTGAAAAGAACAGTTCGACGAGAAGCATAATGAGATTTGGTGCTTGTTTGCCAGG
TTCTTTAAAAAAAAAGGTAATCCACTTAAGATTAGCATCAACTCACTTTTTTGTTTGTTTCTTTTTATTTTTCTTAAAGGAAAACATCCGGACACACATA
TCTGGACAGATTTTAATGCGGACAGTCGGTACATCACACGATGGTCACAGCTAGCCATTCGGTATACGAGCGAAAAGCTAAAAAGGTCACGCTAGATTCA
GACTCTTCTCATAATTCGCGTCAATGAAGGGAATCTTTACTCACTGAAACCTGCTGTTGTGAGGGCTTCGTGCGCTTCTTCTGTAAGTTAATTCTACATG
ATAAGAACTTGATACTCGCCATCTACATCCGAAAATGATATATCCAGCCATTCAGGGCTTGGTAAAATACAATATGATATTGATTGCTAGGTGGATCCCA
TGCCAATTAATAATGGTGTTATTTGTCAGTTTGTTACAATATACATCCATGACAGATGGATGCGTATGTCATATTGCCGCGTCGCACTTCATAAAAAACC
TGGGATCTAGCCAAAACGGATACGCGCATTGGAATGAGGAGGGGGGTTTACCTGGAGAACCCTCCCGACGCGCCCCACCTCCCGAACGAACACCAATTCA
AACATACTGATCGCATTGATGGATACATTTTTGTGATTATTAAAAAATACTGACTAAAACTACTAACAGTAGAAANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN