Description :
From Genome Similarity Track
Location :
Scaffold_1981:2085- 3406
Sequence
1321 bases(100 bases per row)
GCCGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGACTTGAAGGAGTTCACGGGCAAGG
ATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTCTGACCTTTGCGGA
TCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCAACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGT
GGATTAGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGTTGGAATACCTACATCGACTAAATGTGGCCGGTCTAC
GGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGTTGGGAGATGTGGATCTGGCCGACAGGCT
GACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAAGAAGTACTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGC
AAGTATCGCCAAAAGGCCCCGACGCCCACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCTGACTTAGGAACTGAGTCAGGATCCGACGGCTCGG
ACTCCGACCCTGAAGATTACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACAGGAGACAACTCTCGACCGGGGGATACCGTACCCGG
GGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGG
AAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGATGTGGCGAGATTCACGACGTCGGCAAGT
GCCCGATGGAGGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCGGAAGTGGCAGAGAAGATGTTAAACTAGGA
CGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAG
ATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGATGAGTTTGCCAGATCCGAAGTCTCTTCAAC
CCTGGATCTACAAAGGGGAGA