Description :
From Genome Similarity Track
Location :
contig_60:208427- 215790
Transcript NameFunction/comments
g11184.t1RAW43717.1 hypothetical protein PC110_g141 [Phytophthora cactorum
g11185.t1hypothetical protein

Sequence
7363 bases(100 bases per row)
GCTGAGTCGGAACTTCCGCACGACGTACTACAAGACGCTGGGCGTGCCTGTGGTGCAGCACATTGTGGACGTGGACGCGTCGTTCGCGGCGCTGCTAGGC
GAGAGAACGGTGAACGTGCCGCAGCTGCTCAAGTTGGCGCTGGAGTTGGGCATCGCGCCGCAGTACCGCGCGAGGATGTGGCTGCTGCTGGCGGGGGTGC
TGCCGCCGTATCCGGGACTGTGGACGTTTGTGTTGAGGGAGCGCCACGCCATGTTTGAGGATGTGGTGGGCGCGGCGCAAGTCCTGCAGGCGAAAGACGT
GAGCGAAGGAGACGAAGGGGGCGGCGTGTACTACGACTTCTCGGAGCTTCTTGTGAAGGATGAAGACGATGCAGAAGATGAAGTTGCAGGGAAGACGCCA
CGACCTCCTTCGCTGCAGGATTTGAAGAGGCTGGTGCACTTGCATCGAACATATTGGAGAGAGATCGCGGCGTGTGACGCGCCGTTGTTGTGCGGGATGG
ACGACCCGAACTTCTTGCTGGGCGTGGCTCGAGTGGTGTGTGAGGTGCTGACACAGGCACCGGAGCGGTTTTGGTGCTTCACGAGGTTGCTCGAGTTGTT
TCATGATGGTCTGGAGCTTGTGGATCCGATGGTGACGGTGGACACGCTGTACAAAGCACAACTGGCGGACTTTGAAGCCGTGTTTCTCCGTACACTCGAC
GTGAAGCGACGTCGTCTGACTGCTGACGGGTCCATCTCAAGTATGCACGTGCTCAAGAGTGGCCATGATGAGGAGCATGGGCGACGACGGTAAAAATATC
AAATAAGCTGCATGGTATTCAAAACAACCAATCCCTCATGGTCAGTTAAGCAAAACCTTCGACGTTCTCGTCCTCATCCGCACTATCGCTCTCTGCGACT
TGCTGCTTGACAGCAGCCCTGCGTGAGCGACGTCGCCGCTTCGGTGGGGTCTTGAGTTTCAATTGTCGTTCCTTGGGTTTCTTCTCCGTTTCCAGATCGA
AGTCCAGCTGCGCTTGGTCTTTGCGAGCTACGAGCCACGCAGTCATAAAAAGATTCCAGTTAATCTGGATAGGATCTTCCGCGTGAAAGAAATCGTCGAC
AGAAGGGAGCAGGAGTTTCTTGGGGGACCGCTCTCTCACCTCTACAGATTTATCTGCCGTAGAGTGTTTATACGTTGCGCACTTTTCGTTGTCCAGCTTG
TAGTTGGCCTTCAGCGCAAGCTTCAGATGGAGCATCAGTGCCAGTGCGAAAGCAGTGCACCCGTTAGTCTCCAGAGCTGCCAGCTCGGAGCCGGTTAACG
GAGATAGTGGGCGGTATTTGTCGATATCAACTTGTGAGAGGTTAGATTCGTCGTCCTCCAACTTGTCAGCCGCTACACCCGCCTTCGCAAACGTTTCCCT
GAGATCGTCCAGCACAGGGCTAACGAATAAAATAAAACGAAAACACCAGCGGAGTGTGAGATACACGCACGCCCTAAAACTTGACAGGCTACTACATGTA
CGTACCCGAGACGAAGGCTCGCATAGCGGTTGATCAAATAAATAATGTACAGCGGCTCATTCTCCACCTCGTACGGTAGCGCGGCAATGATTTGTGCCAG
GTAGCACAAATATTTCAGATTGCCCACGGTGATGCTGCTGTTGGCGGAGGCAGGTTTGTTCTGTGTCTTTAGAACGCTTCCCTGGGCAGTGAATTGATTC
ACGAGCGCCTGAAGGAAAACGAATCTCGTTGACTTAAGGCAAGTCGTGTACAATCGCCCGAAAAGACAAAATTCTTTGTTGTCTTTCTCGTCCTTCTTGG
GCCTCGAAGCTGTAGCGGTGCCGAATACTCTCAGTTGAAACGAGTACGAGTCCCGGATGCCTTTGATAGACGGCGTGAGGAACTGGCTTGGGAACCTTTC
ATACACCGCCAGCAGCTGAGAAAACGCAGCATCTCGGACGCCCAACACGCCATCCGTCTCCAACGCCACCAAGTTCGGAATGCATTGCAGTGGATTCACT
AAGCCTTGTGTTAGTAGTGCTCCAATGCACCCGACCGCCTCCTGTCGAATTTGCGCTACTTTATGCAGCGATAACAGCAATACATTTCCTAACTCCGCTT
GCATAACGTTGCCAATCAACGAGGCGTCAGCTTCCTGGTCGCCTTGAACTTGCTGTTCTTTGCTTTTGGATCGATCCATCCTCTGCGTCGCCAGTCCATT
TCCCAGTCGCTGCTCTTCGTAAAGTAACAGCTCCTTCATGCTTACAAGGCAATGCAACGTCAACTTGCCAGGTGCTGCAGTTAACAGAAACTTCAACAGT
CCATCTTGCTGAGCCCGTAAAAACAGACGCGGTCGAATAGGGAACAAGAATCCCATGCCTTGAACAGCTTTACCGGCGCATGCATCATTGCCTGGCTTGC
GAACATATTCTCTGTACCACTCATACAGCAACTCTGTGATCGCCCCAATCTTTAGCAGTTTCGCTTCATTTGTCAACTCCTTGTGACGGTCAATATCCGT
CGCTCCCACTATTTTTCCCGCAGCAAACAGTGCTCGCTGAAGAACATAATTATCTTTCTCCGATAAAGTGGTAAGCGACTCCTTAAGTTTGTCCCGCATA
ATTAGGGAAAACTGCTCCAGCAATTTAAGGAGCAATACAGGAGCCATTTTCCTGGTTGAGGACAAAGTTGCTAGGCACTTGACACTCGGATCAACGACAC
TTGGGGGAGATCCCAGCACTAGGAGCCTCAAATCATCTTCAAGCTTATTAGCAAGAGATTGTGGGGGCCTCTTGACACTCAAAATGTGGTCAATCATTGA
CACCGCGAGCCTTTGGATCTTGAAATCGTCCTCTTTCAGGTAAACCCGAAGAGTCTCGATATGACAAGCCAAAATTTGAGGTTTTGCTTCACAAAAAGCA
GTCAAAGCCTTCATGCACGATACAAACTGCAAGTGACCTTCTTCTATCGAAACACCCTGGAGCAGTTTACCTTCCTGGAGGTCCATGAGGCAGGCAACAA
GTCCGCCGACAATTTTCTCGGAGCGATCTTGTGCAATTTCAGCTTCATTCTTACTCGATCGCGATACCTTTTTTCTCGTGCTGTCAGTACGTTCCTCCAG
CAGCCGTTTCAACAATTCAACGAACCAGCTAAAGTTTGGCATGCCATGGATGACTTCAACGATAGTTGCGACAACTTCTGACGTATTATCCATCTTGGAG
TCAATAATCTTTACCACACTAGAGGGAGCCACAGTAGGAGTTCGATACGCAGACCACGCTTCCTCGACTGAGTTGGCGATGTTCCCGCCTTCGGATACAA
ACTTCACATTTTCTTGCGATATTGGTGCAGCAACACCCTTCTCGTCACTTGTACTCGCAACAGCTGCCCATCCAGGTGGAAGATTGCTTCCATCACCAAA
CTCGCCGAGCGGGTTAGAAAGTCGGGAGAAAGCAAGCTCGGCACCGAACCAGACTTCTTGGAAAGTGTCAATGATGAAGTTCTTCACGCCTTGATCTTCA
GCTGCATCTCCAATTCGCTCAACCAGGCACTTCATACAAGCGCTCTTGCGGCGGAGCTCTTGCTCCGAGATTGCATCACCAGACCGATTTTGCATTGATA
TCAACACTACCTTGAAGATCTTGCACACACTTTTGCGAACTTTAATACCTTTGTCTCTTAGCCTCTCTGCAAGTGCGTCGAAATATTTGTCGAACTGTTC
ATCAATGAAAATCACCACCGTTAGAATTAGAGATTGGGTGGATATTGGACATAACGAGCACGAGTCTTTCGTACCAGAAGGGGTTGCAGCAGAACGTAGG
TCCCAATTAAATCCACGGCAGCTTCACGAACTGAAGGTTTTTCATCAGAGCAGCACATCTGAACGGCTGTCTGCACACCGACTTCGGCCATAAGCATGGG
ATCGACGTCGACAATTCCTCGCAAACACTTCATAACACGCGCTCTTAGCGTTGGGATTCCCTTGGACAACAAAGCCATGACGTGCGCAAGCAAGCTGTCA
AACAAACCGCAAAATCCACGTTTTACTGCAAGATGCAAACTCGATTTCAACGCCAACTCATTCGTAGGAGCAGCCACCTTAAATATCGAGCCCACACCTC
CATTTCTCATTTCCCACAAAGAATCCCATAATTTTCTCTCTCGTTCTCGATAAACTGACTCGGCACTGCCCCAATGTGTGTCCAACTCCGACATGAACTT
CAAAAGAAGCAACTTCTTTGAATCACTCTGACCAAAGTTGTGTCGTTGAAGGTGCATCACCACGATATGCTTCAGCGCCATCTGCTGACACCATTGTATG
CTAGCTCTCGGTAGGGCACTTCTGGACCGCGTTTTCTTCCCAATTATTGCTGTGCGCAGGGTACTCATATGCTCTTCAACGATCGCAACAGCATCACTGT
CATCTTTCACACCACTATGGCTGACCTCTTTCTGGTATCGCTTGATTGAAGCGCACATCTTCCCGACCAAGTTAAGTGCAGCCAGGCTGTAATGTGAATC
TGGGCTTTTACCTTCCTTGGAGATATTTGCGTGCAGGATACTTGCCAATGAGGAGCTCAACACTTCGAGGAGCTCTTCAGCGCCTACCCATTCCGGGCGC
ACAAACATTTCCAGGAGGTCTTCAACAAAGTTATCCAAGACCACGCGGTTGTCACGCTCTTCGGACCTTTTCCAGCATGCTGCGAGCAGCTTCCCAACAA
ACGACTGCGCGCTCTTTCGTGTTTCGTCCAATACGGCCGCCACGGTACCATTTTGCTGCTGAGATTTTTCGTCAGTGACAGTATCTGGTGTCGACGAAGG
TTCTATTGAATCGTTCAACAATTCAACGTCAGCTTCCGCTGTCCCAACTTTGACAGCTGGCGCGCAAGACTGAATCATGGACACCGCTACTGTTGATATT
TGCTGCACCATTTCGACTGAGTTAAGTAACTTCATTGTTCGCAGCGTACGCTTGGTAGTAGGTAGCTTTACCATGACTCCAACTATATCGGCAAGAAGTG
AGTCTCGGTGAGTCGGATACTGCAGGAAGATGTTTCGAAGCACTACAAGACCACTTTGTTGTAACGACGTAGCATATGTGCTGTACTCCAGAGTAAACAA
CTCAACCATCGAAGAAGACAGAGGTAATAACCACCGGTCAGCAAGTTTCACACCTAGCACAAGTGTTGCGAGGTGATCCATGAGCTCACACACGACGTGG
GTAACCCCGCTAACAGCCTCACGAATGTTTTTGTTGGTACGCAGATTTACACGAGAAGAGCTCGATGTTTTGCCACCCGTTGACCGGCTCTGATACTTTT
CATTTCCCACTCTTGCCGATGCAGTTGTTGCAAATGTGGTATCAATGCACGGAAGTAGCAGCCGACGAATAATGTGATGCAAGAGCAAAAAACAGTTGTT
AATAGTCTCCTCGGAAAGAATTCGGCGGTCAATCTGCGGTGTTGTCATCACAATCAGCTCACAAATGGCGACATCGAGCGATGCTATGAGACGTTGAACT
AGTCCGTCGTTTGGCTTACAGAGATGGGACCTTTTCTCTTCATTGCTCGGCATCATGGCGGCAAGTACATCCAACGTCAAACCCAGTTGCACCTGCGTAT
CAAATGCGCTCATCAACGAGATCAGCAGCTCTGGCTCCAACTTATTAATCCAATCATTCTTTTCCATGGCTTTCAGTGACTGCAGCAGCAACTTCACTTC
ATCTGACGAGAACACATCCTGGTCACCCAGTTCAAAATCTTCCTGCTGTTGGCGATACATGGCCACATCAACCAATTTCACCAGTAGCTCAGCATACTTC
TCCACACTGTAAGCAGTAATCTCCGCTTGAGTAGGAAGTGCTGGGGGCTCTGCTTTGTCTTCCACCTCCACCTCCACATCGTGCTCGGCATTCAATTCAT
CCAAACAATTTTGCAGCTCGCCACCTTCATCGTGCATCGAGCTCATATCATCTGTAGTGTTTCTAACTGACTGCCTCTTACACGGTTGTTCGTACTCCGT
CTCATTCTGCAGCTCCAGACGTCTCTTCAACTTGTTCGACGGTGATGCTTTCAGACCACGCGCAGACTCAGCTACATGTAGCAGCGTCCAAACACATTCA
CCGTTAGGTCCGCATTAGCAGTATTGTAGTACTATACACAGCTCTTGATTCTCGACAAACCATTGAAGCATCCCGTCTGCACCACCGCCTGCGCCCACTT
GGGCATCGAATTTAGCACATCTGCGTCGATTTCCGTCGTCTCACCCACAGTACTGCAATATTCATCGCCAATTCACAACAAATGCCACGTTAATGCATAT
TATTTACTATACATACTGAAGTTTTTACTGTTCGTACCTGAGTCTGCCGGCGTTGGCAGTGCGGATAAGCGTCGCCATCCGCTGCGGGTTGAAGGTCTCG
GCGCCTGCCACGGGCTCCGCAGCCATAGGATGCACCATCTCGCGCGCATCGGCCGCCACACGTCCTCCGTGTCCACGTACAGTGGGAAGAGAAACAGCCC
ACCCTGCATCGTCCTCGGCGAGAGCACACCCTTCTCTGCTTGTTAATGCGGAATGTGAGTGATTGTTTCCTTTGGTAGAAATGTGGTGTATGGTACACCA
CGTATCTGCTGTCACTTAGAAACGACCTAACCTGCACTTGACGATGGATAAGGCCATTAGACTTAAACTGCAACAATTGCAGTCTTACTCGACTTTCTGG
CGCGGCCTGTGCGCCGGACGCATTTTCCTCTCACCAGACGAGAGAACTCCTGAGCGGAATATGGCGCATAAGATGCGGACCTGTTGTCGTCGTGAGCAAC
GTAAAGTACATGTGCGTTAGCACCAAAGATCACATGAGGCAGAAGCATGAATATATATATAAAGAGCATCGCTCACAATGTTCCAGACCCAGATGCAGTG
CAGAAGCAGCTTGATCGTAGGCAATGGAAGCACTTCTCGGCTCCAGCGAGCCGCTTGACCGGCACGAGAACGTCTCCGTACAGCACTAGGGCTGACACAA
ACAGCACTAAGCGGATAAACTGTGCCAAAGTCCGAGTCAGCCGCATTTTCAACGTGATATGCTTTAAAACCTCAACGTACCAGCGCAGTACTGCGGAAAT
ACACCAAGAGAGTTGCGGCTGTTGCTCCCAAGCGCACCGCCTCCGGTTTATCGTAGTCTAGAGTGCAAGTCACCCCCAGTAGCGCGACCAACCCCTGCAT
CGAAGCTGTTAGAACCGGCAACAACCAGGCGATCCCACCAGTGCGCAGCGCAGAACCCTACCAGTTGGATATAGATCGCGACGTCAGTTGCTCGGGAACG
ACCAGCAGTCGATGCTGGTCCCCACAGCGTACGGTCCAAGTCAGTGTGGTGAAGCACTACCAT