Description :
From Genome Similarity Track
Location :
Scaffold_64:208310- 210738
Transcript NameFunction/comments
Physo_109150PREDICTED: similar to ENSANGP00000020432

Sequence
2428 bases(100 bases per row)
TTGCTTATGTGTTGTTGCTGCTGTTGCTGTTGTTGCAGAAATCGCAGCACAAGATCTCGCCGGACCGCGAGCGCATCATCCGCCGCGCGGCCAAGGAGCT
CAAGGACGGCATGTACGTGAACCTTGGCATCGGTCTGCCAACATTGGCGTCCAACTACGTCCCGGACGGAGTGAAGGTGATTCTGCAGAGTGAGAACGGG
CTGCTGGGCATGGGCCCGTACCCGAACGAAGGCGAGCAGGACCCGGACTTGATCAACGCCGGCAAGGAGACCGTGACCTTCCTGCCCGGATCCTCCACGT
TCTCGTCGTCCGAGTCGTTCGCGATGATCCGCGGTGGCCACGTGCACTTGACCATCCTCGGCGCTCTGCAAGTCGCGGAGAACGGCGACCTGGCCAACTG
GATCATCCCGGGCAAGATGGTCAAGGGAATGGGTGGCGCTATGGACCTCGTGGGCAGCGGCAACCGAGTCGTGGTCACCATGGAGCACAACGCCAAGGGC
GGCGCCAAGAAGATCCTCAAGAGCTGCTCGCTGCCGCTCACTGGCAAGAGTGTGGTGAACACTATCATCACGGAACTCGGAGTGTTCGACGTGGTGCCAG
GAAAGGGCCTCGTGCTGGTGGAAATTGCCCCGACTACGACGGTGGAGGAAATTCGGGAGCGAACCGAAGCGGCATTCACCGTCTCGCTCGATCTCAAGTC
GATGGACTAAGTGGTTATGCGCACAGGATTTCACCGCAAGTATTTCATCATAAACTGGCTGAAGTCTTGAACATGTTGAACGTAAATTGAAACAACAAAA
GTGTGTGAGGTTTCAATTTTTCAAGCAAAATCTTTGGTTTTTGCAAAAACCACTCCATTTCTGGAGCGTGGGATGGATAAGACTTCGAGGCTTTCAGGAC
CAAGAATAAATAGCTATTCATGATAGCCCCGTCCAGATCGAAGCTGGCACCCAAGCATTTGATTTGTTGCCGAGTGACGAGTGCTGCAATGGCATCCAAG
GGCAACGACAAGGAGATCGACTACGTGTCCAAGCAGGCCAACCTCACCGCTCAAATCGAGAGCGAACGGCAGGCCGCCAAGAAGTGGTGGGACGAGTACG
GCATGTGCTACCTGGAGAACGCGCGGCCCGAGGACTTTACGTACGATAGCCGCGTGCTTGCTCTCAAGAAGAAGCTCGAAGACCCGAAGTAAGTTAAACT
GCCCTGTATGTTTTTATTTTGCAAGTCCCTGATCTCACCAGGCTTTACCCTGCACCATTTTGCAGGTTCCAACATGCCGCACTACATACAACGAGCACAG
ACTATGGCTGCAGGCCGCCATTCAAGGAGTGCCGAAAGAAGATATGAGGCAACGCCAGGTGTTTTACTTCGAAGTATTGGTGATCAGCTAAAAAACATGG
ATTAGCTCGGCTGCTCCGCGAGAACACTGAAAATCATACAGTGGCTGCTAACCGCGTTGCGGAGAGTGAAGGCATCAAAGAGACTTAAAAATGATTAAAT
GCTTAATAGGCGTCTTGTTTTCCGGCTGCCAATGTCAATGCGTACTGGATAGGCTTGCACGATGGCAAATTGAAAAGTGATTATTGTGCCTTTCGTTTAA
GTTGCCGACAGCAAAATCGGACTTCAAGTCCGATTATCATTTACTAAAACAAGGGAGATAGTCAGTAATTCGTTATACTATAGCTTTCCCGAAAATCGGA
GTCCGGTTTCCTGTGCTTTGCTCCTTCGGTGTTGCTCTCGTTTTCATTCGAGGTCCCGAATGGCGGTGATTTGTTCGCCACCTGGGACGTCGGCTCGAAA
AGCGCTACAGTATCGCTTTCAATTGAAAAGCGGAGTCGGATCACCATCCCTCCGATTTTTCAAATCGGGTGTTGGGGTTTATACGATATGTTGGGCCGAC
AGGCCCCGACATATCCGACACCGAACTCCGAACTCCGATACTCCGCCGCATATTAGTTTATAAGTTCAGTTTAGAATTGAGCAGAAACGATGGAGGATGT
TGGCGAAGCTACGCCTGGAGCAGCGTGAGGTCAAGCGACTAATCCATGAGGCTCTGAGCAAGAAGAGCTTCCCTCCTGTAGTTCAGCACCCCGAAGCCAT
CCGAGGCGACGTGTTGCTCTCTTCCCTGTTTCAATGGCCTGTAGTCGTCTGGGTTCCTGAGTGCGCTAACCCTACCCAAAAACCGTACTGCATCATGCCA
GGCTGCTCATGCACACCTAGGGTGAAGGAGTACAAGCAAAGAACAGTTGAGGACGTCGATAGCAAGAGCCACCTCCTGTATATCAAGTATCAGTGTGCCG
GCGACCGCAAGAGCTGTTTTTCTACGGTGACAGCAAGCTACATCCAGCGCGAAGCCCGCCTACTCATGCATTTCCCCTATGTGATGACAAAGAAGTTTGG
AATTTCGAAGCAACTAATGGAACTGGTG