Description :
From Genome Similarity Track
Location :
Scaffold_98:2083- 4097
Transcript NameFunction/comments
Phyag_g2010hypothetical protein PHYSODRAFT_345503

Sequence
2014 bases(100 bases per row)
CAATTGACTTTCACTTGCATAGCTCGCATTCGTTCCTGTAGCGCTTTGGTCTCGAGTTGCACGCGTCGCCGTTCCTCATTCAAAAGCTCTTCGTAGCTCG
CCCTGGGAAATACATCATGGTTATTTGTTaggcaccaccaccaccaagtaCTACGGTTCTCGGATCGTGACGTACGCACGAAGTCTGGCCGAATCAAGCG
ACGAAGGTGCATGTGGTGGATCTGACGTGCCTGCAGAACCATCGATACTTGCAGGTCCTCGTTGACTGGGACTAGCACTTCGGACAACTGCCCCCATGTC
ACTGGCAGGATTCGCCGACGGTCTCTTAGCCACACCTTGAGCGTGCTGGTCGAGTGGATCATTACCGTAGTCAAGGAAAACTGCACACGACATCTCTTGG
TCAATGCGTTCTTTGTTTCTCCGAGCAGCCGCCTGACGGTACGGCGAAAAGTAGTTAGGTCTCCACCGTAATTTGTCCACAGGTTCCAAAAGTCAAGTAA
GGAAAGCTCACCTGGTTCTCGAAAAAAAGTTGGCGAGCATGGTTTACCTCCGGGAGCTTTGGAATTGATGGCTGCGCGTCCATGATATTAGCGATTTCTT
GGTCATGGGAGACGCTACCATGGTAGTTTGGTTGGCAGCCCGAAGGCGATGCCAAAGGTGTGGGGATTTCCTGGTCACTGTTTCGTGCAGCAatctgctc
aagaagcatGGGCTGGTGCGATGTCGCTACGCTCACCAATTGCATCATGTGGCACTGAACGGCGTCACACCTCAGAATGTCGGAGAAATCTGGTCGTCTC
TAGAGGGGATTCATGCATCGAAATCGGTGACTTGGAGTGCAGTCAATCCGTACAGGTCAACCAAGGTTACGTACTCGGGGGTCTTTCTCGAGCAAATGAA
GCACAAGAGATCGGAACAGTGAAGAATATCGCTGTGAAATAGGCGGTGGTTCGCTGTGAAGGATTTTAACCACCACGGCACCAAGTGCGGGGCCGCTGAA
TGGTGGAGAAAAGGTGGCGAGCTCGTACAGCACACAGCCAAGGCTCCACACGTCGCATTTGCTGTCGTAAGCGTCACCTTCCAATAGTTCGGGCGCCCTA
ATGCCAAGCGAAGGTGAGAAAACTGCCCCCAATTCACCAACGTGCGTAGACGAAATATAGCTTACATGTAGTACGGGGTTCCGGTGGTGGTTTGAGCAAG
GTCAACAGAGCTCTGCAAGACCTTTGAAACTCCGAAATCGCTTAGCTTCACGATAccgtcgccgtccagcaAAATATTCTGGGAAAGATGATCGAACGCA
GCGTGTTTCAGTACGAGGAGAGGATAATGTACGAGTACAAACGGTGAGAACCTTCGGTTTGAGATCGCTACAAAAAAGATCGTCAGCAATTGTAGTGAAT
TGTTCGGACACTAAATAGCTCATACCGGTGGAGGATACGATGCCCGTGCAAGTATTGAAGTGCCAGTACGATCTGGATGAATATGCGCATGATGGCAGGC
TCGCTCAAGTGTCCCCTATAGgtagaagagcagcaacatgtGAATCAAGAACGATTAACTTTACCAATTCCATATGAGAGCATACGCGGACTCTTGCTGC
CACCGCAAGAACGCGTCCAGATCTCCTCCGCTAGTGTACTCCATGACAAGAACCGACTGCGTGTCGTCCtcaacgagttcgacgaATTGAACAATATTCA
CATGATGCAATCGCATCAATAGTTGGGCTTCCTGTCGTGCTGCCTGCTTAGCGTCCTCTTTGTGAGGAATTTTCGCGGCGAAGAGCTTACGATCCGAGTT
CCGTCGAACGAGCACCACATTACCGAATTGACCGCTGCCGAGCACGCTCATTGTTTCATACCCACCTATGTCTCGCATTCTGCAGAACTCCACTGCAGTG
GAGTCACGAAGTGTGTCAAGTGGACTCACCGATTGAGTAAGGTTGAGGTCCGTTTTACTACGGTCAAGTTAGAGCTAAGAATTCCTTTTCTTGGTTAGTG
TACATGAACGTATC