Description :
From Genome Similarity Track
Location :
Scaffold_249:20829- 23493
Sequence
2664 bases(100 bases per row)
ATGCGTCACCGACCTCACTTCAGCTTCCACTCTATACCTTTGTTGAGATGTTTCAGTGGCCCTCAGCGTACGTTTCGGCTTTACCATGTGCGAATCCATA
AAGTGCAGCGTTCCTTCCGTACTCGAAAATATGTTGTTTCAGCTCCACCATCTCTGGTAGCGGCGTGTTCACAGGACCAGGTTTCCTGCCTCTCACATGG
TCCGCTCGTCGAAACATGGCGCTGGTGTCTTCTCTTCCTCGAGTATCTTGTCTACCTGCGCTCAATCATTTAGCGGGACTTGTGACTTCATTCCACCTTT
TAATCCAAACGCTTCCTTCATCTTGTGCTTCCACGTCATCATCTCGACACCCACCAAACAAGTCTTGGAATTTGACAACGTCAATTCAAAAGACCTGGGG
TCACACTAATATCCCATTGCTCGTAGTAGAGTCACAGTGTTGTCGGACAGTTCCTCCAGCGACATTCTACTAAGTGGTTGTAGCAACTTGCCCCTTAAAG
GCACCCATGTCGAATGGTAAGCTGTTCTCGGAATAAAACAGCGAATTCAGCGACCTTCTTTCATTTCCTCGCCGAGTCAGTTCAACGTCGAATTAGCCCA
GGGGTATCGTTACTCAATGTAGCCCTCGGAGCTAGCGGGGTAGATCACCAAGGTTCACGTCTTGATCTATATCTTCTTCTTCTTCTTCTTCGCGCTCGTA
GGACACGCATCCATCAACCACGCGAGGATTGCTGCGATGGACCACATGCAGCGACTGTTTTTCCGAGTCTACCACTGTCGTTTACCTCAGATATTCCATC
CTCCTCGCTATCCTGGTCACTCGCTTTAAAATCGCGGAACGGGATGGCTTGTTCCACCAGGTTTCTCCAGGATGATATTTGAATTCGCTGAGTTCAGCTC
AGCATGCGGCGTTCGTTCGGCTGTTGCCGGGGTCAAACCGCTCGCATTTATCGATACATTGACCGTACCGTTCCTTGGTTGCTTGGTAACTACTAAAACA
ATTAAACACCCTGAATCCCCGATAAACGGGACCAGTTTTAGGATAGTAATTAGTTAAATATGCGATAATACAGTCCTAACGTAACAACACCACGATTGCC
GATTAAGTCGGCGCAGTTGCGCTATACGCCGGGAGAAATTCCTGTTAAAAACAAGCTCAACGAGTACCACTACGCCATCTGGCCAAGCTGTATGAAATCC
TCATGGCGAGGATTTTTTATTTTCGCGAATTCTGTGGGATTATCCCATAATTATTGTTCTTTAGGAGAATGGAGTTGATGTGCGACTGCGTATTGACTAC
AAGTTAGTCGACGCCGTCACTGCAGGAATGGAATACGCGATGCCTCAAGTCGATGACTGATCCCGATGGCTACTAGTGTTTCTGCTTACTAGAGGCCGCC
AGCGGGTTTTCGGTCGTGATGATGACATATCGTGCTCGCCTTGTATCTGCAGTCGTGTGTGCGGTATGGCATTTCGAGTGGCTTCGTATGCTATTCGGAA
TCAAAAATGCTCCTTAGATTTACCATACGCTCATAGAAAATGGTCTGTTGGGATACGCTCAATTAAAAGGTGGATGGCAGGTCTTCTCCGTAAAGATGAA
GTTGCAGAAGTCGATACAGCTGGCAAAAATAAACGCAGCGTAATGGGACTCGACGAGTTAGAAAACGACACAATCACGATGACCATGATAGATTATGATT
AACGATAAAACGACGAGGCTGATCCGTTAAAATGCCTGGTTAATGACCCTAAAGGCGAGATGTTTCTCATACGAGAAACCGACGAGCTGGCAGTCACAAC
AGTGTTTTAGCGCAGGGTGACATCAGCTTCGGACGCACGAGCTTTGAAAAGTATTTTGCTATCCACGAGCGATTGTTGGTACGTTTCACGGTGTATAGCA
GCAGCACCAGCTTTATTAAGAGCATCTCCGTGCAACCCCAGATTAGGTTTTGTCGCACATATTTACCGCGCATGGTATTACGGCCGACTGACCAAATTCA
ATAAAATCGACAAGCGGTCGTTTCCAACATCCAAAAACATTATCTTAGCGTTCCTTAGAGCTATTAACATCCGCAGCCGGTTTATCCAAAATATAGCTTT
CTATGGAGCTGCGTTAAAAATGTCAATGAGGAAGACTTCGTTATCGATTCAAACTTGTCAGCAGCATGTGCCTCTTCTGACCTCTTACAACAGCAGATTT
TACGAGCGCGATTGTACACCGTTTATTGATTCATGTGATGAATCACGCTATTGGATGGGCGTTAAGTAGCACCTTGATGCAAATGCAAATGCACGACGTC
AAAAGGCACCCAGTCAGATTAAAGGGAACATTGTTGAAGGAACTGAAGTCAATTATCACCCAGATGAACGAGAAGTGCTAGCGTTACTAAAATTGTTCAA
GAATACGCACATTTCTCCTAGCCGGGAAAATCTTTACGCTTCAACCCTCTCCTAGACGATGTAATAATTGCTTACGTCTAAGGCGTTGAATGGACGCGCA
GTCAGCTTTTCAGTGCAGACTACCACATATCACATAGAGATAAAGAGGTTGAGCAAGCGCGACGTAGTTACTGCAGGCGTCAATCACGATAATTGTCGGC
TTCAACGAGTCACTCCAGCATATTACTTCACCTCCCAAGCACTCGGCGAGTCTATGGTTAAATA