Description :
From Genome Similarity Track
Location :
Scaffold_652:20828- 23061
Transcript NameFunction/comments
Phypl_g10086DNA replication licensing factor MCM5

Sequence
2233 bases(100 bases per row)
GTGACTACTTGACGCGGGACACAAACTTGTACTGGCTGAGCTGCCGGAGTGACCCCTTCTGCACCATAGCCCGAATTGCGCGTTGAATGGCATTGGGATT
GTAGCCCTGCGCCTCGAGCCGACTGTACAACGCACTGGTCTCGACACGCGTGCCAATACGCAAGGTGCGGTTGATGCTttgctccacctcctgcgcTTTT
TCATGGAAACCGCCGAACAATCCTTGGGTGCcgccgtccttggccgcGTTCATCGTACTCACGCTGAACAACCGGATAGCCTCCTGCACGTGGTCGCGGG
TGGCTTCACTAAGCAGGTGCATCTTCGCCAGCGATTCCGAGATACGCACAAGGGCCTCAAGTTGACGCACAGTGACCGGAATGGTCGTTTCGCCTCCCTG
GGTACGACGCACGTCGTCACGTACACCAACGTAGaagtcctgcagcgcctgagCCGCTCCAACCGACAGCTTTGGCGCGCATCGCGTACGGCAATACGTG
ATGAACTTCTTCAGTAGCCATGGCTCGAACTCGCCGCCACTCGAGGCATTCTCACCAGCTGAGGGTTTTCCagcggccgacgccaacgcATTCGTGTGCA
TCCGCACAACGTGGGCAGCCATCTGCCTATCCCTTGCGTCGTCCTGGATATCGCGGACAATGAAGATCATATCGAAACGACTCAGAATGGTGCTCATGAG
GTCGATGTTCTCCGAAGCAGAGCGCATATCATCGTAGCGACCGAACACGGGGTTCGCAGCCGCCAGCACGCTGGCACGCGAGTTCAAAATGGTGGTGATA
CCAGCCTTCGCGATGGAAAtggtctgctgctccatAGCTTCGTGAATGGCCACACGATCCGACTCGCGCATCTTATCGAACTCATCGATGCACACCACGC
CACCATCAGCGAGCACCATGGCACCTCCTTCAAGGTAGAACTCACCCTTGGCATCACGGATAACCGACGCCGTGAGACCCGCAGCACTACTCCCTTTGCC
GGACGTGTACACACCCACAGGTGCGATTTTCTCCGTAAACTTGAGGAACTGGGACTTGGCCGTACTGGGGtctcccagcagcagcacgttgatGTCACCG
CGCAGGATCATTCCATCCGGCAGTCTCTTCCTCGAGCCCCCGACCAACAAACACGCAATGGCCTTCTTCATGTTCACCGTGTAGTCGCCGTAAATCGACG
GGGCGATGCTCCTTGCCAGTTTCTCGTACAGCTTGGGGTCCCTTGCCATTTCATGGAATTTCTCTTCCTCCGCCGGTGAGAAGGTCGCTTTGGCTCggcc
ggcgccttcttcgtcgatcTCGATGCCCACCACGCGCAAATACAGCGTGCGGATGGCTACAGCGCCGACATTTTTGGCTCCCGCGTTGACGACCGACGTG
ATGCCGACCACCGAAACGCGCGTTCCGGGGGACGCTCTGTCCACCAAGTGACGATCCGCAATCAGCGCCAGATTACGCGGCATCTCGCCAGTCGGCACCA
CTTCGGGGTTCTCCTGCaacttgagcgtctgctggtCCACGTACGCGCCTTTGTCCGGCAGCACCATGTACGAGTCCTTCGGGCACATGTCTCCGGCGGT
GAcgccgttctcctcctcccGGTTTCGGTCGCAGATGCGCGGGATGCTCACGCCGCCCATGCCGGAcacggccacgcgcttggTGTGGCCGCAGTTGCGA
CACCTCAAAGTTGCCGACACGCACTTGGTGCGCACTCGAGTGGCGCTGATTACGATTCCGGGCACTTTCACCAGGCGGTTGATCTCCTGCGAGTGTACGT
GGCGAAGCGCCACTGGGGCTTGGTCACTGGTCAGAATGGCCTGGATGTCCGGCAAGGTTGCCGTGGCGTTATCAGAAGTTGACGAATCTGCGGCAACCGA
CTCTTGCGCGTTGGACACGAGCAGTTGCGCCAGCATTTGCTTGGCCGCACTCTCCAGCAGAggcagctgctccttcggGCTCTTGAGCAAAaggtcctgc
agctcttggtcGAAGGCCGCCACGTGCGAGACGTTCACAGTCACGAACCAGTGCTTGCGGCGGGCGTtggccaggagctgctcgcggtAGTAGAACAGCG
GGCCCACGCGGAACCCGCGCAGGAAGGCTAGTAGGCGGCGCTGCAAGGCCGCGGGACTCGCGGCCTGACGCACGTCCGACACCTGCGCGCTCTCCATGCC
AACGGCCGTCACGCGGCCCGCATCCCAGTCCAT