Description :
From Genome Similarity Track
Location :
Scaffold_297:20826- 21862
Sequence
1036 bases(100 bases per row)
AGCGCGCCGTCGAGCCGCGATGTCGCGGCGGTCAGTGGCGCGTGGAGCGCCGCCCACTGCTGGTACTCCTTGAGCCGGCGGCGGCGCCGAATGCCTTCGA
TGACGTAGACGATGAAGCAGATCGCCCAGAGCCCAAAGATCACCGTCTGGTCCGCCATGGCGAGTCGCACGTGATACCTACTGCTTCTCAATTGTCTCGC
TTCTTCTCGGAGCGAAAATGATGCGGGTCATAAAGTTCCAGTTTCCAGTCCAGAAAAGGCCAGACTTCAAGCGACCGCGCCCATCTCCATGCACGACCTT
CTTCTTTTCTTCCCTCCTTCAACATGAGCGGAATGGAGAATATCTCACCACGCCATGGCTTCCATATCGATACCCACAGGATACTCACCCCACTATGGCG
CGGCCCTCACAACTCAACTCTTCTAGCCACCGGCAAATCCCATCCTTTCAGCCTGCCGCAAAGATGATCGTGGGCAGTACTGAAGCGACCCAGAACCGTG
TGACTTGTCATGGACCAGGGCAACATCGACTGCGTACTGCGATCAAAATCCGAGCTTTGAAAGCAAAGACGACTTCAGGAGCCGACGCGACCGTCACCTG
CACTGGGATCGGTCGCTCGCGAGTCCCTTCTTCTCGGTCTGGAACAAAGATCACGCCGTTCACTGGGGCAATTCACTGAGCTCTACAAAATTGATACACG
CGGCCTCCCGCTCATGTTCCACGGCCTGCAAGCCGACGAGTGTTTGATCTTCGGCGCGATTCCGAACGTGAACGTTTCCCAATCGCATAGCGTGACTGCC
GAAGCCGACGACCTCTGAGAAGCACGAATGAATAGAGAGCGCAGTCCGGATCGACGCTACGCCCCCATGGCGCGAGTACAATGCCGAAGTCGAAGGGGTG
GTACTCGGATGAAGATGACGCGTACAGCGACATTGACGAGCAGCATCTTATCGAGTATTACATGAACCACTTAGCTGCCAACCAGCAGCCTACAGTGCAC
ATCAGCATGCAGCGTAGATTACGGTAGGGCGAATCA