Description :
From Genome Similarity Track
Location :
contig_60:208247- 215607
Transcript NameFunction/comments
g9091.t1hypothetical protein
g9092.t1hypothetical protein

Sequence
7360 bases(100 bases per row)
GCTGAGCCGGAACTTCCGCACGACGTACTACAAGACGCTGGGCGTGCCTGTGGTGCAGCACATTGTGGACGTGGACGCGTCGTTCGCGGCGCTGCTAGGC
GAGAGAACGGTGAACGTGCCGCAGCTGCTCAAGTTGGCGCTGGAGTTGGGCATCGCGCCGCAGTACCGCGCGAGGATGTGGCTGCTGCTGGCGGGGGTGC
TGCCGCCGTATCCGGGACTGTGGACGTTTGTGTTGAGGGAGCGCCACGCCATGTTTGAGGATGTGGTGGGCGCGGCGCAAGTCCTGCAGGCGAAAGACGT
GAGCGAAGGAGACGAAGGGGGCGGCGTGTACTACGACTTCTCGGAGCTTCTTGTGAAGGATGAAGACGATGCAGAAGATGAAGTTGCAGGGAAGACGCCA
CGACCTCCTTCGCTGCAGGATTTGAAGAGGCTGGTGCACTTGCATCGAACATATTGGAGAGAGATCGCGGCGTGTGACGCGCCGTTGTTGTGCGGGATGG
ACGACCCGAACTTCTTGCTGGGCGTGGCTCGAGTGGTGTGTGAGGTGCTGACACAGGCACCGGAGCGGTTTTGGTGCTTCACGAGGTTGCTCGAGTTGTT
TCATGATGGTCTGGAGCTTGTGGATCCGATGGTGACGGTGGACACGCTGTACAAAGCACAACTGGCGGACTTTGAAGCCGTGTTTCTCCGTACACTCGAC
GTGAAGCGACGTCGTCTGACTGCTGACGGGTCCATCTCAAGTATGCACGTGCTCAAGAGTGGCCATGATGAGGAGCATGGGCGACGACGGTAAAAATATC
AAATAAGCTGCATGGTATTCAAAACAACCAATCCCTCATGGTCAGTTAAGCAAAACCTTCGACGTTCTCGTCCTCATCCGCACTATCGCTCTCTGCGACT
TGCTGCTTGACAGCAGCCCTGCGTGAGCGACGTCGCCGCTTCGGTGGGGTCTTGAGTTTCAATTGTCGTTCCTTGGGTTTCTTCTCCGTTTCCAGATCGA
AGTCCAGCTGCGCTTGGTCTTTGCGAGCTACGAGCCACGCAGTCATAAAAAGATTCCAGTTAATCTGGATAGGATCTTCCGCGTGAAAGAAATCGTCGAC
AGAAGGGAGCAGGAGTTTCTTGGGGGACCGCTCTCTCACCTCTACAGATTTATCTGCCGTAGAGTGTTTATACGTTGCGCACTTTTCGTTGTCCAGCTTG
TAGTTGGCCTTCAGCGCAAGCTTCAGATGGAGCATCAGTGCCAGTGCGAAAGCAGTGCACCCGTTAGTCTCCAGAGCTGCCAGCTCGGAGCCGGTTAACG
GAGATAGTGGGCGGTATTTGTCGATATCAACTTGTGAGAGGTTAGATTCGTCGTCCTCCAACTTGTCAGCCGCTACACCCGCCTTCGCAAACGTTTCCCT
GAGATCGTCCAGCACAGGGCTAGCAAATAAAATAAAACGAAAACACCAACGGAGTGTGAGATACACGCACGCCCTAAAACTTGACAGGCTACTACATGTA
CGTACCCGAGACGAAGGCTCGCATAGCGGTTGATCAAATAAATAATGTACAGCGGCTCATTCTCCACCTCGTACGGTAGCGCGGCAATGATTTGTGCCAG
GTAGCACAAATATTTCAGATTGCCCACGGTGATGCTGCTGTTGGCGGAGGCAGGTTTGTTCTGTGTCTTTAGAACGCTTCCCTGGTCAGTGAATTGATTC
ACGAGCGCCTGAAGGAAAACGAATCTCGTTGACTTAAGGCAAGTCGTGTACAATCGCCCGAAAAGACAAAATTCTTTGTTGTCTTTCTCGTCCTTCTTGG
GCCTCGAAGCTGTAGCGGTGCCGAATACTCTCAGTTGAAACGAGTACGAGTCCCGGATGCCTTTGATAGACGGCGTGAGGAACTGGCTTGGGAACCTTTC
ATACACCGCCAGCAGCTGAGAAAACGCAGCATCTCGGACGCCCAACACGCCATCCGTCTCCAACGCCACCAAGTTCGGAATGCATTGCAGTGGATTCACT
AAGCCTTGTGTTAGTAGTGCTCCAATGCACCCGACCGCCTCCTGTCGAATTTGCGCTACTTTATGCAGCGATAACAGCAATACATTTCCTAACTCCGCTT
GCATAACGTTGCCAATCAACGAGGCGTCAGCTTCCTGGTCGCCTTGAACTTGCTGCTCTTTGCTTTTGGATCGATCCATCCTCTGCGTCGCCAGTCCATT
TCCCAGTCGCTGCTCTTCGTAAAGTAACAGCTCCTTCATGCTTACAAGGCAATGCAACGTCAACTTGCCAGGTGCTGCAGTTAACAGAAACTTCAACAGT
CCATCTTGCTGAGCCCGTAAAAACAGACGCGGTCGAATAGGGAACAAGAATCCCATGCCTTGAACAGCTTTACCGGCGCATGCATCATTGCCTGGCTTGC
GAACATATTCTCTGTACCACTCATACAGCAACTCTGTGATCGCCCCAATCTTTAGCAGTTTCGCTTCATTTGTCAACTCCTTGTGACGGTCAATATCCGT
CGCTCCCACTATTTTTCCCGCAGCAAACAGTGCTCGCTGAAGAACATAATTATCTTTCTCCGATAAAGTGGTAAGCGACTCCTTAAGTTTGTTCCGCATA
ATTAGGGAAAACTGCTCCAGCAATTTAAGGAGCAATACAGGAGCCATTTTCCTGGTTGAGGACAAAGTTGCTAGGCACTTGACACTCGGATCAACGACAC
TTGGGGGAGATCCCAGCACTAGGAGCCTCAAATCATCTTCAAGCTTACTAGCAAGAGATTGTGGGGGCCTCTTGACACTCAAAATGTGGTCAATCATTGA
CACCGCGAGCCTTTGGATCTTGAAATCGTCCTCTTTCAGGTAAACCCGAAGAGTCTCGATATGACAAGCCAAAATTTGAGGTTTTGCTTCACAAAAAGCA
GTCAAAGCCTTCATGCACGATACAAACTGCAAGTGACCTTCTTCTATCGAAACACCCTGGAGCAGTTTACCTTCCTGGAGGTCCATGAGGCAGGCAACAA
GTCCGCCGACAATTTTCTCGGAGCGATCTTGTGCAATTTCAGCTTCATTCTTACTCGATCGCGATACCTTTTTTCTCGTGCTGTCAGTACGTTCCTCCAG
CAGCCGTTTCAACAATTCAACGAACCAGCTAAAGTTTGGCATGCCATGGATGACTTCAACGATAGTTGCGACAACTTCTGACGTATTATCCATCTTGGAG
TCAATAATCTTTACCACACTAGAGGGAGCCACAGTAGGAGTTCGATACGCAGACCACGCTTCCTCGACTGAGTTGGCGATGTTCCCGCCTTCGGATACAA
ACTTCACATTTTCTTGCGATATTGGTGCAGCAACACCCTTCTCGTCACTTGTACTCGCAACAGCTGCCCATCCAGGTGGAAGATTGCTTCCATCACCAAA
CTCGCCGAGCGGGTTAGAAAGTCGGGAGAAAGCAAGCTCGGCACCGAACCAGACTTCTTGGAAAGTGTCAATGATGAAGTTCTTCACGCCTTGATCTTCA
GCTGCATCTCCAATTCGCTCAACCAGGCACTTCATACAAGCGCTCTTGCGGCGGAGCTCTTGCTCCGAGATTGCATCACCAGACCGATTTTGCATTGATA
TCAACACTACCTTGAAGATCTTGCACACACTTTTGCGAACTTTAATACCTTTGTCTCTTAGCCTCTCTGCAAGTGCGTCGAAATATTTGTCGAACTGTTC
ATCAATGAAAATCACCACCGTTAGAATTAGAGATTGGGTGGATATTGGACATAACGAGCACGAGTCTTTCGTACCAGAAGGGGTTGCAGCAGAACGTAGG
TCCCAATTAAATCCACGGCAGCTTCACGAACCGAAGGTTTTTCATCAGAGCAGCACATCTGAACGGCTGTCTGCACACCGACTTCGGCCATAAGCATGGG
ATCGACGTCGACAATTCCTCGCAAACACTTCATAACACGCGCTCTTAGCGTTGGGATTCCCTTGGTCAACAAAGCCATGACGTGCGCAAGCAAGCTGTCA
AACAAGCCGCAAAATCCACGTTTTACTGCAAGATGCAAACTCGATTTCAACGCCAACTCATTCGTAGGAGCAGCCACCTTAAATATCGAGCCCACACCTC
CATTTCTCATTTCCCACAAAGAATCCCATAATTTTCTCTCTCGTTCTCGATAAACTGACTCGGCACTGCCCCAATGTGTGTCCAACTCCGACATGAACTT
CAAAAGAAGCAACTTCTTTGAATCACTCTGACCAAAGTTGTGTCGTTGAAGGTGCATCACCACGATATGCTTCAGCGCCATCTGCTGACACCATTGTATG
CTAGCTCTCGGTAGGGCACTTCTGGACCGCGTTTTCTTCCCAATTATTGCTGTGCGCAGGGTACTCATATGCTCTTCAACGATCGCAACAGCATCACTGT
CATCTTTCACACCACTATGGCCGACCTCTTTCTGGTATCGCTTGATTGAAGCGCACATCTTCCCGACCAAGTTAAGTGCAGCCAGGCTGTAATGTGAATC
TGGGCTTTTACCTTCCTTGGAGATATTTGCGTGCAGGATACTTGCCAATGAGGAGCTCAACACTTCGAGGAGCTCTTCAGCGCCTACCCATTCCGGGCGC
ACAAACATTTCCAGGAGGTCTTCAACAAAGTTATCCAAGACCACGCGGTTGTCACGCTCTTCGGACCTTTTCCAGCATGCTGCGAGCAGCTTCCCAACAA
ACGACTGCGCGCTCTTTCGTGTTTCGTCCAATACGGCCGCCACGGTACCATTTTGCTGCTGAGATTTTCGTCAGTGACAGTATCTGGTGTCGACGAAGGT
TCTATTGAATCGTTCAACAATTCAACGTCAGCTTCCGCTGTCCCAACTTTGACAGCTGGCGCGCAAGACTGAATCATGGACACCGCTACTGTTGATATTT
GCTGCACCATTTCGACTGAGTTAAGTAACTTCATTGTTCGCAGCGTACGCTTGGTAGTAGGTAGCTTTACCATGACTCCAACTATATCGGCAAGAAGTGA
GTCTCGGTGAGTCGGATACTGCAGGAAGATGTTTCGAAGCACTACAAGACCACTTTGTTGTAACGACGTAGCATATGTGCTGTACTCCAGAGTAAACAAC
TCAACCATCGAAGAAGACAGAGGTAATAACCACCGGTCAGCAAGTTTCACACCTAGCACAAGTGTTGCGAGGTGATCCATGAGCTCACACACGACGTGAG
TAACCCCGCTAACAGCCTCACGAATGTTTTTGTTGGTACGCAGATTTACACGAGAAGAGCTCGATGTTTTGCCACCCGTTGACCGGCTCTGATACTTTTC
ATTTCCCACTCTTGCCGATGCAGTTGTTGCAAATGTGGTATCAATGCATGGAAGTAGCAGCCGACGAATAATGTGATGCAAGAGCAAAAAACAGTTGTTA
ATAGTCTCCTCGGAAAGAATTCGGCGGTCAATCTGTGGTGTTGTCATCACAATCAGCTCACAAATGGCGACATCGAGTGATGCTATGAGACGTTGAACTA
GTCCGCCGTTTGGCTTACAGAGATGGGACATTTTCTCTTCATTGCTCGGCATCATGGCGGCAAGTACATCCAACGTCAAACCCAGTTGCACCTGCGTATC
AAATGCGCTCATCAACGAGATCAGCAGCTCTGGCTCCAACTTATTAATCCAATCATTATTTTCCATGGCTTTCAGTGACTGCAGCAGCAACTTCACTTCA
TCTGACGAAGAACACATCCTGGTCACCCAGTTCAAAATCTTCCTGCTGTTGGCGATACATGGCCACATCAACCAATTTCACCAGTAGCTCAGCATACTTC
TCCACACTGTAAGCAGTAATCTCCGCTTGAGTAGGAAGTGCTGGGGTCTCTGCTTTGTCTTCCACCTCCACATCCACATCGTGCTCGGCATTCAATTCAT
CCAAACAATTTTGCAGCTCGCCACCTTCATCGTGCATCGAGCTCATATCATCTGTAGTGTTTCTAACTGACTGCCTCTTACACGGTTGTTCGTACTCCGT
CTCATTCTGCAGCTCCAGACGTCTCTTCAACTTGTTCGACGGTGATGCTTTCAGACCACGCGCAGACTCAGCTACATGTAGCAGCGTCCAAACACATTCA
CCGTTAGGTCCGCATTAGCAGTATTGTACTACTATACACAGCTCTTGATTCTCGACAAACCATTGAAGCATCCCGTCTGCACCACCGCCTGCGCCCACTT
GGGCATCGAATTTAGCACATCTGCGTCGATTTCCGTCGTCTCACCCACAGTACTGCAATATTCATCGCCAATTCACAACAAATGCCACGTTAATGCATAT
TATTTACTATACATACTGAAGTTTTTACTGTTCGTACCTGAGTCTGCCGGCGTTGGCAGTGCGGATAAGCGTCGCCATCCGCTGCGGGTTGAAGGTCTCG
GCGCCTGCCACGGGCTCCGCAGCCATAGGATGCACCATCTCGCGCGCATCGGCCGCCACACGTCCTCCGTGTCCACGTACAGTGGGAAGAGAAACAGCCC
ACCCTGCATCGTCCTCGGCGAGAGCACACCCTTCTCTGCTTGTTAATGCGGAATGTGAGTGATTGTTTCCTTTGGTAGAAATGTGGTGTATGGTACACCA
CGTATCTGCTGTCATTTAGAAACGACCTAACCTGCACTTGACGATGGATAAGGCCATTAGACTTAAACTGCAACAATTGCAGTCTTACTCGACTTTCTGG
CGCGGCCTGTGCGCCGGACGCATTTTCCTCTCACCAGACGAGAGAACTCCTGAGCGGAATATGGCGCATAAGATGCGGACCTGTTGTCGTCGTGAGCAAC
GTAAAGTACATGTGCGTTAGCACCAAAGATCACATGAGGCAGAAGCATGAATATATATATAAAGAGCATCGCTCACAATGTTCCAGACCCAGATGCAGTG
CAGAAGCAGCTTGATCGTAGGCAATGGAAGCACTTCTCGGCTCCAGCGAGCCGCTTGACCGGCACGAGAACGTCTCCGTACAGCACTAGGGCTGACACAA
ACAGCACTAAGCGGATAAACTGTGCCAAAGTCCGAGTCAGCCGCATTTTCAACGTGATATGCTTTAAAACCTCAACGTACCAGCGCAGTACTGCGGAAAT
ACACCAAGAGAGTTGCGGCTGTTGCTCCCAAGCGCACCGCCTCCGGTTTATCGTAGTCTAGAGTGCAAGTCCCCCAGTAGCGCGACCAACCCCTGCATCG
AAGCTGTTAGAACCGGCAACAACCAGGCGATCCCACCAGTGCGCACGCAGAACCCTACCAGTTGGATATAGATCGCGACGTCAGTTGCTCGGGAACGACC
AGCAGTCGATGCTGGTCCCCACAGCGTACGGTCCAAGTCAGTGTGGTGAAGCACTACCAT