Description :
From Genome Similarity Track
Location :
Scaffold_165:20824- 22782
Transcript NameFunction/comments
Phyta_totarag4901hypothetical protein PHYSODRAFT_332774

Sequence
1958 bases(100 bases per row)
GATGCCCATGCAATTATCCAAGTAACGGCCAGTGCACTGAGAGCTGCCGGCTGCAGAGTGGCTGTGCACATGCTGCAAGCTCCGGACTCGGAGGTGCTGT
CCCCTAATAAGGCGGAGACGCAGGCGTACGCGTTGACAATTGGCAGTGAAGTGCCCGACCAAAGCGTCACGGAGAGAGGCGAGTGGGCTGGCCGCGTGGC
CATGCAATTGACTCCGTGGGTCACGCAACATCCGGATTTTACTAGTCACGTACTGCCTCTTAAAGGAGCTGCACAGTGTCAACGGCTGTGTAAATTAATT
CTGACCGAGGTGAGACTCGAGTTGGATGTTTGTTGCTTGCATGAAGCAGGTCACGACGCAGCGACGGGGGCTCCGGTCTTGCTGCGTGCGAGGGAGAAGC
TACTGCCACAAGTGATGAGAGCCGAGGGGTTCACGAATGTGGCACTGTATCCACTGCATCGAGATGAGGCGAGACGCCAATTGACACGCAGATGGGGAGC
ACAGAGCTCGTTAGCGTTGCCACCACTCGAAGACATTCACGCGTACTTTGGGCCGAGAATCGCCATGTATTTCGCTTGGCTCGCTTTTTATACCAGgatg
ttggtgctgccaGGGGCTTACGGAGTTGTGGTGCACGTTCTTGGACTGTTAAATCTGGCACCGAGTTATACGGTTCACTGCGTCTTGGTGGCGGTTGGGA
CGTCGCTTATTGCAGATATGTGGAGACGCCGACAACGGGAGGTGGAGTTTGCCTGGGGCTACGATGGTGTGCTGTCGTCCCTGCACTCGACTACGAGGAT
GCAGTTCAAAGGCGAGTGGATGCAGGACCCCGTGACTGGAGTGCGATGCTTCGACTTCCCACACCACAAGCGGGTTTTACGACAACTTTTGGCCGTcccg
ctgctggtgtccatgtgctgcttggtgggGGGATACGTTATTGGCTTGCACGTGCTTTCGGAACGTCTTCGGGCGAGCTACAGCGACAGCTGTACGCAGA
CGTGGGCTCGCGACGAAAGTCTTGAGACGGGTGATGACTACTGGGCGTATGTTGTTGATAACTGGGTACCCAGCAACGACGCGATGACTTGTGCACTCAT
TTCGCACGGCCCGAGTGTGATAAATGCTGTTATCATTCATGTCATGGACAACCTGTATCAGTTGCTAGCGCGGAAGCTGACTGAATTCGAGAATTATCGC
ACACTTAACGAGCACGAAGCACACCTGGTGGCCAAGCGGATGCCGTTCCATCTCGTGAATAGCAATGCGTCCCTTTGGTTTCTCGCATTCTACGTACAAC
GCTTAGACCGAGTTCGAGAGCGACTGTGGATCTTACTCGTAGCTTCGCAGCTGCTTGACAACTTCAAGGAGGTAGGCTTGCCACTCGCTGTGTCTGTGGG
CGGGCAAGTGCTTACAGCAGAGAACAAACGCCGTCGTCGGCAGAGTCTTGAGAGCCTGCAGAGTGAGACTATTGAAGGCAATCACCGTCTTCAGCGGAAG
AAATCGGGGCCACTACTGAGAGCCAAGCGGGAACGAGAGCGAGTGGATGTAGCCAAAGTTATTACTGAGGAGCGGTTGGCACGAGTTCTTATGCAAAAGC
GGCAGGCCACGTATCGAGACACATTTGCGGACTATAAGGAGCTCATGGTGCAATTCGGCTATGTTACCCTTTACAGCCCGGTGTTtccactggcagcagc
attCGCGTGGTTGAACAATACGATCGAGAGTCGGTCCGATTTACTCAAGCTTGTAAACCGCCACGGCTATCAGCGACCAATCGCGCAGCACGCTCGAGGT
ATTGGCGTCTgggagaaggtgctggtgagCTTCGCAGGGGTGGCTGTTGTCGTCAATTGCGCGCTCGTCTGGACCTACGAActtgacgagctgcttccTT
CGTGGACTGACCTACAACGGTTTGCCTTCATTGTGGCGTGTGAGCACGTAATCTTTGT