Description :
From Genome Similarity Track
Location :
Scaffold_64:20822- 22692
Sequence
1870 bases(100 bases per row)
CGACCAAACTACCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGCTCA
GTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAG
CCTTACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGATCCCACGAAGGGATGTGTTGTTGAACA
ACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATTCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTAAGCGC
TCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTG
CGTACCTTCGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGTAGGTGCATCTAGGACACCTCCGTCGAG
TGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCAACGT
GGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGTTTGGCCAACTAC
CTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTTTTGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATG
CTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCTCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGC
CATCGGATGTGCATTGCTGCAGGCCGACACGGCTGTACACGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCCGTC
CATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTAGACCCTTTGTGATCTACACAGACCACGCGTCCT
TGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAA
GCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCTTGACTATGAGTTGGCCCACATCACGCGGATGACAACGGATCTATATGATCGGATACGCATGGCG
TATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCC
ACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACAT
CCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCAGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAG
TGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGGTT
GTTGGAAGTCGATGAGTCTTGACTTCATATTTGGGCTTCCCGCCGACGGACACGGTAACACCGGAATTTT