Description :
From Genome Similarity Track
Location :
Scaffold_5:2082168- 2084038
Sequence
1870 bases(100 bases per row)
TCCCGTGAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGCCTTCGGTAGTGGGATCACAAAATCGATCGAGACGATCTGGAAAGGTCGT
TCGGCTAGTACGTTGCCAGGTGAGTATCCACAAAGCTGCGGACGGCTTTTACTTGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCAGCGT
ACAAGCCGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTC
TTGAATCATCGTTGTCGGTACCACAAGCCACAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTCT
TCTGATAATACGAACCGGTCGGCATACTTCCAGGCATCTCGAGCTTCTTTGTAACTCAGCTCTTTTGCTTGGCCCTGAAGCACCTTCTTGATGTTAAACC
ACTTCTGCTCCTCGTCTTGTGCCACCATTATTCGTCTGCGTCGTTCCCGCTGTATTGCTGCCGGATCAACATCCTCCGCATCTGGAAATGCCTCTGGTAC
AGTCTTGTGAGGATGGTCTGGCAAATCTTCGCCGATTGAATCTTCCGTGGACGTCTCTCGTCGTTCTTCATGCTGTTCTTGAGCTTTTGAGACCTCCTCC
GAGTGTTTGTCTGCAACCCTGACGTGTTTCTTGGCTTTCGTCTGTCGCCGAGTCATCACTGCCATATTACCATAATCACACTCTGGTGAGCCGTAATCAA
CCACGAAATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCACGTGACGAAACATCTACCGAGTCTTC
ATCCGGCTCGTAGATCATTTTCTGGATGCGATTCAAGCGACGCCAATTCCGACTTGCGAGTTTCAGCCAAGATGACCCGACTGACCTTTGATTCTAGCGC
TTCAGTGGCTAACGAATCCGCGGCAGCGTTGTATTCTCGTGCAACGTGTAGATATTTAGCTGATCGAAGCTTGGGCGCGAGTTCCTTGTGAGTATTCAGC
AGCGCTAGCAAAGTTTTCTTCCTGCATGCGATCACCCCTAGTGATTGTTAAATCGCGAGCCTTAAGTCACCAACGATGACTAAATCCTCGGCACCGTGCG
CGATAGCAGCCTTGACACCGTTTATCATACCTGTATACTCCGCTTCATTCACCGTGGTGGCCGAGAGGTAAGCGTTTGCAGCAATCACTATCTTCCCCTC
AGGAAGGCCCCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCGCTGTAATTACGG
GGAAGCCTGGCGTACAGCAACGCGGGGTCTATTCGAATAGACGGGGAACCCTTGTTTGGAGGTGCCACCGGCGCGAGTGAGTCTTCCAAGTCGACGAAGC
GCGTGATGCTTGACTGCAGGAGCTGTGCGAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTCAAATGCCACTGCGAAAGCAGCACGGCGAACTGGAC
CGCGCGTCCGAAGAGCGACTTCGACTTGTGCACCCACTCTAACGTCGAGAATCGTGTCTAAACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATC
TCCAACAGCAGAAGTAACGCCAAAACTTTCTTCTCGGCAGGATGGAAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAACCGTACGGGGTGTAACT
TGTCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCACTCGCAAAGAGCATGACGTGAACTGC