Description :
From Genome Similarity Track
Location :
contig_118:20821- 22107
Transcript NameFunction/comments
g13329.t1POM75848.1 Taurine dioxygenase [Phytophthora palmivora var. palmivora

Sequence
1286 bases(100 bases per row)
TCACTTTTCAACTTGCACTCAAGCGCCATGGCCCCCATCAACATCGACTCCACCTCCACCACTGCCGGACCCACTGCCGCGGTGGTAGTCACACCAATCA
AGAACGCGCTCAACCAAGAGGTCGAACACGCACCCTTCACCCACCCGGAGCTGCTCGGAGAGTTCCCCACCAAGACGTACGATCCGATCCCCGTGCTGCC
GTACAACGACCGCGCGCTCAAGGCCGATCCGTCGTTCAAGAACCTGCTCGCGGATGCGACGGTGACGCACCTGGAGCCGAAGATTGGCACGGAGATCTCG
GGTCTGCAGCTGCACGAGCTGACGGACGCGCAGAAGGACGAGCTGGCGCTGCTGGTGGCGCAGCGCGGCGTGGTGTTCTTCCGCGAGCAGGAGATCTCGA
TCGAGCAGCAGTTGGATCTGGGTCGCTACTACGGTCCTCTGCACGTGCACCAGACGGTGGCTCACGCGAAGAGTATCCCGCAGGTGCACGTGGTGGAGAA
CTCACTCGAAGTTAGCGAGAAGCGTATCAAGTCGCAACTGTATGATCATGTGAATGTGTGGCACAGTGATGTGTCCTATGAGCGCCAGGTGAAGAAGTTT
GGGGGGGGGGGTATGTTCTGTACATGTTTAGTATATTAACTTGTGTGACTTGTAGCCTCCATCCTACACGAGTTTCAAGGTCTTGACTACACCACCCACG
GGTGGAGACACGCTGTGGGCGTCTGCGTACGACGCGTACGAGCGTCTTACCCCACCGTTCAAGATATTAGTTGAAGGACTGACCGCCATTCACAGCAGCA
AGGTACGAGCACTTTACCCGCTTGCTTACGGGGAAAGCTAGTGTACTGATTGATTATTGACGCAGCATCAAGCTGAGGCCGCTATCGCTCAGGGTCTGAC
CCTGCGCCGCCCAATTGTTGAGTTCGAGCACCCCGTTGTCCGCACCCACCCTGTCACTGGCCGTAAGGCCTTGTTTGTGAACGACCAATTCACGACTCGC
ATCAAGAACCTCTCGGTGGCCGAGTCTGGTACGATATTTAGTCGTATTGATTCCAGTAGAAAGCTATGACACTGATTTGTGTGGGTGTGTTTACAGACGC
GGTGCTGCACTTCCTGATTAAACACATCGCGGAAGGTCACGAGTTCCAAGTGCGCTACCACTGGACTAAGGACTCCGTGGCCATTTGGGACAACCGAGCC
ACGATCCACTACGCCACGTACGACTACCTGCCTGGCAACCGCCACGCTGTGCGTGTGACGCCTCATGGCGAGATCCCGTACTTCGA