Description :
From Genome Similarity Track
Location :
Scaffold_454:208207- 210128
Transcript NameFunction/comments
Aphin_H310_10599predicted protein

Sequence
1921 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGGCCACGTGGCTCGTGGCCCCTCA
GCCCTCTGAAGTAATACAGTCTTGGATTTGCCTTACGAAGGAGGCAACTTTGCGGTCGGAAGCCGTGAAGGACGAACAAGCACCATTTAACGCGAGAAAA
CTCGCAAGCGTTGTAGGCAGCATCATGTAACAGGTAGAAGAGACACGGATGCGAGGAGACCGGAATGTCGAAAAAAGAGAAGTGGTCTGTGAGAGAAACC
CATCCGCCAGCAAAGGCCAAAGGGCCAAGAAGAGCACGACATCCTAACGATGTGGCGTGGCCTTCGCTACAACTCACGACAACATGACGAAAAAATCTCT
AGAAGGCACAAAACACTTCGTACCGTTGAGGGATCATCCTACAACCTGAGGGGCAGGGCAGTTGGGATGATCTCGATAGAGCCGGGTGTTCGGATTGTCC
CTGCACTTGTCCGCTTGGATGACACCAGCAATCACTAGTCAGCTTGGATGAAGCCAGGAATGTCGCACCGATAGTATGACCGCACATACAAAAAACAAGA
AAAAGGCGTGTCGTTAGGTTGCCGTTTCTAAAGGCAAGGCACGCAGCTGTCTGTTGTAATCGGCCCTCGTGCAAGCCACCGAGCTTCGAGACGCGTCGAT
ACACTAGCACTCGATTCCTCGCGTATCAATCAACTGCCCGCCGCCTCAGGTGGACAGTGCTGAGCAACGACAAGAAACTGGGTTGCCATGATAATAATGA
GTCTAGTGGAACGAAATGCGCGCCAGGTGCCAGATGGCAGTTGTTCTGGTGCCATGACCTCCTACATCCGCAGTGGAGACAAGCCCTTCGAGCAGCTGAC
ATTTCACAGCTGTGTCCCTCTGCGCAATCTCGAAAGGTGTTCGAGTAGTTCACTGCGTACTTGCATTGCTCACTTGCTCCTGCCATGAAGCGTATTACTG
CGCTGATTGCCGTCGCCGGGGCCGCCATGGCCTCGCGCAACGAATCGTCCGCGTCTCGCGGACTCCAAACGACGACCGCGCCGTTCTGCTGGCTCAACTC
GTATCCCCGTGGCGTTGGCAAAGTACCCAGCTCGTGCGCGGCAGGCCAAGAGCGAATTGGACTGTTGTGCTACCCGAATTGTCCTCCTGGCATGTCTCGT
AAGGGCCTGGACTGCCACTCGAACTGCCCCGAAGGCTTAGAGGACCAAGGCCTCTTTTGCCGCAAGAAGGAATACGGCCGAGGCGTTGGCTTCCCTTGGA
AGTATGGCGACGGTCTCAGTGACCACGGCATGTTCGAACGTTGTGAAGCAGCCCACGGCACCGGCAACTGCGAGAAATACGGCCTTATTGTGTACCCGAA
ATGCGAAGAGGGGTACACCGCCTTTGGCTGCAGCACTTGCCGCCCCAAGCCACCAAACTGCCAGGAGTATGGACTGGCCGGCCGTTTCGACCTGTCTTGT
GCAAAGAAAGTTGTCATCGGGGATCCCGAGTTGGGAACGTGTGCGTCGGGCGAAGAGCGAGACGCTGGACTGTGCTACAAGCAGTGCAAGACAGGCTTCT
CTGGCGTCGGACCGGTCTGCTGGGGCCCTCCCCCGTCTGGTTGGGTCCGATGTGGCATGGGAGCCGCCACGACCTCGACTCAATGTGCCGAAATCATGGT
AGACCAGATCATGTCGGTCGGCGAGATGGTGCTCAATGTTTGCACGGCGTTCTCGTCAAGCTCAGCTAAGGCGCTCCAGGCCCCGGTCGACTCGGAGATC
TTGGCCAAGCTCAAGAACGGC