Description :
From Genome Similarity Track
Location :
Scaffold_691:2082- 5732
Transcript NameFunction/comments
Phypl_g10348hypothetical protein
Phypl_g10349hypothetical protein

Sequence
3650 bases(100 bases per row)
ACCCCGCCGGAGTATTCCGCGCGGTGTTGGGTACTTGGGGCGGTCGACTACAGGCCCGAGCGGGGCCCGCAAAGGTTCCGCCTCCGTGGATCCGGCCTCG
GTAGTGGCCTGCAGAGCGAGGTTCTGCCACTCCATGTAGCGGCGAGATCCCACCACCATGAAACCTGGAAGCCTTGGTACACGATCTCCTGCCAGCCATA
TGCCAACTCTCTCGTCGCCCTGCAGGATCAACTTGTTCTCACTGACGTTGGTGATCTGTAGGTACCGTGATCGCCCAGGTCCCTTATCCAACGTCGGGAT
CCAGCGATCTCCGCGAGTAACCCACAACTTGTCTTGTCCCGATGCCTTCAGGCGTAGCGATAGCTCCACGGACTTCCCGATCTTGATCTGCATGGCTGAC
CCAACCTCAAGAGTTTCGCCTTGTCATtgtggagctgtcgccgtccGCTGAGCTGGATCTTGACCTCATCGGGCAAGGAGATGGATCCATCCGCGAGATC
TAGCCGGATCCCCGCCGGAAACATGAAGTCCATACCCAGTATGTCTTCCTGACCCGATAGCTCGCCTACCCAGATATCGAAGAAATACACCAGCGATCTT
GCTAATGTAACCTTGATCCGAGTTCTTCCTTCCGTCGAATGCACGTTCTCACCAATCCCAACACATTCTTGGCTTTGACTCCTGTCGATATAGCACCCAA
CCTTACGAGCAAATGTAGTATCCACGATGGACACTTCGGCGCCGGTATCTAAGAGTAAGACTGCCTTCTCATGGTTGATCTTGCCGGTGATCTTGGCCTG
TCTAAACCACTTACCCGGTGCATGACGTTTCCGATACCCTCGTGACTCTCCTGGCAGGAGACCTTAAGatactgcagcaccaggttgGCGATATTCGTCG
ACTCGACGTAGATCTGGTGTGATCTCGCCTTCCGTCGGCCCTAACCATTGATCTGGGTCTTGCTGCTTCCAGTAGCCCTGGCGGGCGCCTGGATCGAGAT
TCACAACCACTGCACTGTCGGATCGAGAGCAGTCATCGGCTTGATAAATACTCGAGATCACAGCAGTACGTTTCCAATGCAGTTCACATGTATTACCGCG
TAGATCTGGTAGCTTGCAAACTTGATCTAATGGCGTCTTGTTCACAAATGCAAAGATGCAATACCTAGAACGCTCGGCTCGTATCGGATTCCAACCCGAC
GAGCGTCCTAGTTTATCATCTTCTCAGCAATAGCAGGCCACATGCCCTCGTGCTTCGTTGGATTGTACCATTGACGGATCTGGTTGTAAAACTCTTCCAT
CGGGCATTCCCCCATGTCGTGAAGCTCTCCACATCCGCGGCACACGAAGAGGCAGTGATCGGCTGGATGGCCTCTCTTTCCGCACTTCTCGCACATCAGG
CGCCTCCAACATCCGAGATCCGTGTGTTTACGGGGTCCATAATGCATACAACGGCTACGATCAGATCCATCAGCTTGGTTCCGAGGACGGTGATCACGTG
GAGCTTGATCCGTCGCGTGTCGGTCCCCTTGGTTTCGATCCGCGCTGTTCGtgtcttcttgagcttgcaGCGCATGGTCGTTGCTACCAGCGAGGTAGAT
CCGGTGGTACTCGCCACTATCTGAGTCCGATCCGTCTGATCCGGAGTCAAATCTCGACTCTGGCGCTTGGGCCCGGACTGCGCGAACATGTTTGGCCGGG
GTCGTCGGTGCTGACGTTGGCGACTTCTGTCGGTACTTGTTGGATCCATacgcggccttcttctggcgATTCTTGGCGCGTTCCAGCGCACGAAggactt
cttcgagctcgtctGCATCTGGAAGTCGTTGCAGTGTCAAGCGATCCGCCAGATCTTGGTCGCCCAGCGTCTCGACGAAATGACCGACAAGTTCACGTCG
CTCTTTCGATCCGCCGTCCTTGATCTTCAGGCGCGCCCGTAATCCGGCCACGTTAAGCCGATAGAGGAATTCCAGCGGCGATTCGTCGGATCGCTTGCGC
GCATGATAGTACTGTCTCGCCACCGAGACGCTAAGACCGCAATACTGGTTCTGGAAACTTCGCAACAGTTATTGCGGGTGGATCGAGCCAGTTGGCGATA
CCAGGTCCTCGCAGGCCCAGTCAGCAGATCTGCGAACGTCAAGCATTTTTCTTCACCCGAGGCTTGATCACGCATGAACGCTGACTTGACCTTGCCGATC
CAAACTCTCGCCCGATCTTCGTCTGGATCCTTCCCAGTGAACTCCTTGAGATCCGAGATCGCGGAGATCCGGACCCGTTGGGTCATGGATGTCCCTTCTG
ACCCGGCGGCAGTGGAGGCCACAGCGGCGCGAGCGGGACTCGTGAAATCCAGGTCGTCGGGATCATACTCCCAGTAGGATGCCTCATGATTTGGCGATCC
TACCGACTCCATCTCCGCGTCTTGCGATCCGGCGTTCTATGCTTCTTCGGCGACCGGGACAGTTGCTGCGACTTGCTGTTCCGCTAAGAACCGACTCATG
GCAGCTTGGAAGTAATTTTGCAGCGAGCCTGGCGGCTCGTTCGACGGGATAGCGGCTGCGATCTGGCCTGCTGCGGGAGCTGACTTCTTCTGCCAGCTCG
ATCGCGGATCCTGACGTCGGATCTTCGATCGCGCCTCCGGCAGCGATGCACCGGAGGGAGCGAGCACCATTCGCCGCGGCTCTGACGAAGCGTCCGATCC
ATCCTCGGCTGCCGAAGCACAGTGTGACGACGCAGTAGTGCTGATCCGGGATCTTTGATCCGGGGATCTGGGAGCTTCGCCGACCAAGATCTTCAGCTTC
TCAAAGAGATATCGCGTGGAGAACTGGATCGAGTCGAGATCCATATCGAACAGGTCATCCGCGTCGAACGCGCCGTCGAGGATGCCTGCTTCCTTCAACA
GCCGTAGtagctcctccaccacctccagcttaTTGTCCGTCACCACAGGAGCGGTCACGAGTTCCTTCGGATATTGGATCTAGTTCAGCTTCAGGGTCTG
CATCACCGGATCCTGATCCAGGAAATCGCGTAGTTCCTTGTGGTGGAAGAAGTGCTCCAGAACTTCTTCGGACCAGCTGAACGCGGGTTCGCTGGTATCC
TCGCCTTCCAGCTCTAGagccttcatcttcatccgcgtagtcttcttcttcgtctttTCTTGATCAACTTGTGAGACTAGCAGGGTCTTGTACGGGTACG
GCATTAGCTTAACCGGTCGATCTGCAAATGCATAGCGTTCAGCCTTCACTTTCCCTTCATTTGTTGACGGATCTCGACGCGGGTCGAGATCCGCCGGGGT
CCCCGGGGGACCTGTGGAGGAATTGGAGGTTTCTCTTCTAGATCTGTCGCCAGGTCGCCCTCCGTTCCGTCGACAGAGTTCCTTCCAGCACTCTGCCGAT
CCGTGGATCTTGCTTCattcagcagcgtcgtcgtcgatcccAAGTCCGATGACGCTTGCTTCCCTTTTTCAGTCTTCACTTGAACTTCTTCTAGGGACTC
ACGGTGAAATCCCGAGTCACCAAAAgatccgggcacgcgcaccattGTGGAGTAGCGGAATCAGCAGAGATATTGTTAATGCTGGATCCGACTTCCCACt
gcgcccagacaccgactaacggaggggNGCTTCctatagcgggatcttga