Description :
From Genome Similarity Track
Location :
Scaffold_946:2082- 4386
Sequence
2304 bases(100 bases per row)
ATGTCGAAGGTTTGAATTGAAGCGGCAATACTTGACAAACTTTCACCGCGACATTCAGGTGCATCGGAAGCAGAAATTATTGGCTTCTGCAACGGTGGCA
TAGTAGAGGTCGTAAACGTGTCTGCTCTGTTTCGTTATCTTCTGAATGTTGCCCGGACAATATGGCTGCAAAGATCGATTTTACCGACCCGACCGCCGCA
CGCGTAAGTAAGTAATACAAATCTCCCCTAGTCGGAAAATTACACCACAATACTCGGGGTCGCTGCATAGTTTGCCTGTGCGGACGTGTTGTATAAGAGC
CGGCTAAGAGTACCAGTAATCTGCTTCTCGGTGTCTCGAGTCGGTTCCGGGTGCGTTCGTTGGAACTGCTCCGAGCCCTTCTTCATATGGTTCGGATATA
CCGACAGCGCTCCCTCCTTATCAATAATACCGAGCTGCAGTCCCATGCGTAGCACACGTTATGTAACCCTGCTGAATCAAGTGACCACTTTGGGCCTTTT
GAATCCCACTCCATGGACGTACACAAATGATAACGAGCGAAAGCATCGCGTTTGTTTGCATCGTGTGTAGTAGCTACGGTGTTCCTCCATGGAGATGGTG
GGGAGCCCCCAAAAAGAGCCGTGACATCGTTGCTCGTAAAAATCTATGATTCGTTTTGAATAGTGGTTATCTTGAAGCAAACGGAAACCTATATCGTGCT
GACCTTCCACGACGTGTTTCTTCGCGGTATTCCGTTTTGGTTTTGAAAGGATGTCCACTAGACACTCAAATTCTAATGGTGAAAAAATTTACCCCGACTA
TAATACGAGTCAAAAATGTAACTTTACCATCGACCTTAAACGTTCTCACACCATTTCCAGTACATCGACGAGGCAAATTTGCCTTGGAATCATCTTCCTC
ATTGGCTTGATCAATGAACTCAGCTAATTCTTCTTCAATCGAATTGCAATGTTTATGATTCAGACGGCAATCGTCGTTGTTAAACGAAATATCGAGATCA
CCATTCCAATTTCACCTCGTAACGTTTTCGCATATTCAACAAGAGAAAAAGGGAATGCATACCAAAACGAATCGCTCAAGATAAATGATCAGTTCGCTGT
TATGGCATGAACCATGTGACCATTCATGGCCCCGGGAAAAGCTGTTCATGGTCGTTATCGCCAAATCTTTGCAACTCCGGAATTTGCGTCATCTGCTCGA
CTTCGATATGTTTGGGTACGAATAACGGGCTTTATGCGGAGTTTCTTCCTTCATCTTATAAGATTGTTGATATTCCTCAATCATATCCCCCGAATTTTCG
CCGTTAATAATCGATGTATTCGTATGCGAGCATGTGAGTGCCGCAATAAATAAGATTTGTCTCAACTACCTTATTATCCGCGGCTTGCCTTCTAAGCACC
CACAACAAAGGTCGTCGCAATATCGACGAAATGTTTCACCTGTTCAGTGCGAATACCCTCCGCCAATGATGCGGTAAACGAAGGTCTGCAGCGTGTGATC
TACGACAATGGGGCGGACGCCGACGCGGTTGTTGCCTTTGCCCTCACGTACTATCATCAGCGGACTTTTGGAGCAGTTTCATGGACGCCTCCACTGGCTA
AGCGGCACATATACTTTCCGCGGTTTCCCTTGAAGCAATTAGATTGTTCCAATATAAGTTCGTGGTAGAAGCACGCCTTTCCGCAGTAGTTGTGAAACCA
GCGTAATTGACTTCAGCGTCGGGTAGTGCAATCTGAAATGATTTTGGTAATCCATTTGGTTGAACGAAACATTCTTCTCGGCATTCGTGCGCAGTTTCTT
CTAACCTTGCACACCGACTCAAGCCACGACAGCAGAGCAAATACGAGCACATTATTCGCAATAAAAGTGCAGGGTTAAATTTGGATCCGTAGAGTGATAT
AAGAATATGGAGTCTTTCATCGGCATGCAGCTCGGCAACGGCCGCGTGAGTAGCCAACGTCTCGAAAGCTCCGTATTCGCCCTGGATCCTGTGAAATTCT
TGTGTCACTAGTTCGTTTACAGTGCAAAGTACGTTCAAATAACTGCTTCGTACACTTTTCAAACACGCGGGCAGAGAGAGAGCAGGATATATATTGGGCA
CAGCTAATCTAGCCCGAGCGCTCAACCTTACAAAATCTGGTAAATCTTCTTGGCAGCATTTTTCCGTTTAAATATAATTTCAGTACGGTTCCACGCCTTA
CGCTCGCGTAGTACTGCGATACGGTGTAGTTAAAGGCCATAATGCTCTAGAGGCGCAATAGTAATCGATTGCTGAGGTATTCCATAGCGAGCGCTGAAGG
CACC