Description :
From Genome Similarity Track
Location :
Scaffold_1:2081976- 2085517
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00544hypothetical protein
Phypa_INRA-310PPTG_00545secreted RxLR effector peptide

Sequence
3541 bases(100 bases per row)
GATGACCTTGCGCGTCTTGGGTGCCTTCTTTTTGCCACACACCTTACGGTGCTTGGCCATGTTTGACTTAGACACCAGCTTGCCGCACGTGGCGCACTCG
CCCTTCGGAGCCTTGCTGGTGTTTCCTTCCATTCGGATGTTTTTCTACGACTGAATGTTTGACGTAAAAAAGAGTCTGAATGGATACACTTTTCGCGATC
GCTGATTCGCTGATTTGTGGTTTTTGTTTGCACGATTTTGATTGGCTAATAAAAATGTTGTTTCAGTGTTGTTTCGGGGAAAGAAGTACGCGTACTCATC
TTGCCGATACTTGCAAGTTTAGTTACATTTATGTAACAACAAGGGTGACGACCAGTAAAGCACCGATGAATTCGAGCAACGCGTGGGACTGATTTTGCCC
GGCACATGCGAAGCGGGTCGCTCTGGTACGGTCATGGGGTGAAATGCAGTGCAACCTGTGAGCCTAAAAAACGAGCCGTTTGAGTTGGTATGGCGCGAAA
GCGTTAACGCCTTCATGGGATAGAGCCTCCCAAGTTTCGGGTGAGTATGGAAGCACTTGTTCAAGTCAACAAGCTGGGAAATTAGTAGCCGGGCATTGCA
TTGTCGCTGTGGCTTTGCGTTGTAGCTGCAGAGTTGCTATGTTATCCGGTATGATTAACTTATTTTTAACGTCGGGTTATGTTCTAGTTTTAGATACACG
AAATAAATTTGTCGTTGTTTTAGTGGCGCTATTCACAAGCCAAGGTATCTGGCATTTTAGGGGAAAAGCTTGTTTTCGAGTAAATGTTGGTGGATATTTA
AGGGAACAGAAAGGCAGTAGTTGGTCGAGTAAGCATTCCGATGAGATTATGTCCGAGTGGTTGTAGAAGAACTGCGAGTAAATCAATATGTATTGTGAAT
TTCGTCCAAATTTGCCGATTTGAGTCTGTTTGAGGAGCGGGAGGACAATCGCCACGATACAAATCCAAGTCATTAGTAGAACCCACCAAGTCTTTTCTTA
CCGCCAAGTCTTACTCGAATTAAATCCGCACTCACATTTTAGACGACAGAACCTGGTTGGATTTGGCCCACCGGTTAGTACACTTTGCGTATACAGTGTA
TATTCGCCAGGATTGTCTTACGTGCTCTAAAGCGTTGGTTATTGGGCTAGTTGCTGAGAAAAGATGGCGTGAAGGTGCCATCGTTACTACAGAATCTCCC
GCTTAACTTTGGCACAAATATCACTGGTAAGCCTAATAAAAGAGAGGATAGGAAAGGGATTGTTTAACCAACTTTCTTTTTCTTATAGGAAAATAACATG
GAATAACATAAGACGTTTCCCCATTGTGAAAACACCAGTAAACGAATGCTTTGTATATCTGGGCAGATTTAAGAACGCCGCAACGTGCTCGCAACAACGT
CGTGTAGTATCTTATCAGCCTTCACTATAGAGACATCAGCTTTCACTACATCTATCTTGGTGATAACGTTTGTCTAGCCGGAAGACAGGGGCTTCCATTC
AATGAATTGCCTACGGAGCTTTTCAGATCTTTCGTTCGTAGCAGGAATCCTTTCCAGCATATTCTTCAACTGAGTTTCACCGAAAGCCTTCACAAATACG
CCTACCAAAGTTTCTTTTGCTGACTTCTCTCTGTTGTATAGCATTATATACTTGTCCAGCGTTTCCACTCTGCGGCTAACGATTGAGGATAGGTCGTTCT
TCTTAAACTCCAGAAGCTTGAAAACGTCATCCACGGACTTTTCGCTGTGTAGCCAGCCTTCCAATTGCTGTTTCTGCAAACGTACAGCGAGCATATTCTC
CTCCTTCACTGCGGATACGATTGCCTTTGCCACTCCAGCCTCTCCGTACTGCTTCGTCAGCACCCCGAGCAGCGTCTGCTGCTTGCTCGGATTCATCCGG
TTGAACTCAATTATGTACTCATCAAGTCTCCTGAGCTTTATACTTTTCAGAGCATTTTCCACATCATCACCAAGACTTAACAGCTTCATGACTCTTTTTG
GCTCTAGTTGTTCTTGTTGCCAACGCCTGAGATTCTCCAATTCGATGGCCTTCGCTCTTGTAGCAGGGACGTGTTTTGCCTTCGTTAAAATTAACCTAAA
GTCATCATCACCCCCAAAGCCCGTAGTCAAGGCCCTGAGCAAAGTCTCGTGGCCATTTTTCTCGCTGTTGAACTTCACAATATAATCATCAAGTACCTCC
AGCTTTCGACTTACGAGCGCTACAAATTCGTCATCATGAAGCTTGAGCGAGTTGAATACATCAACGACGGATTTACCACCCTCCAACCAAGCAGAAGTTT
GCTCAGCCCGCAGCTTCTTTGCCAGCTCCGCCACATCCGGTGCTGAATCTGCGTGTCTTTCCGCAGATACTAGCGCTTTCGCCACAGCATCGTCTCCGTA
GCGGGCTGTGAAAACCCCGATCAGTGAGATAGTGTTGTCCGGGTACTTCTCGTTGAACATCGCGATGTACTTCTTCAAAGTGTTCATTTTCGAGCTTTTC
AAAGCAACCGCGACATCGTCTCCAAATTTTAAGCTGTTCAACACGTCAACTCCTTTATTTTTCATGAGCAAAAACGTCCTTAGCTTAGTGTCCTCGGCGA
TCTTCGATGCGGCAGTCTTAATTGCATTGACGACATTTCCTAAGCCAACTCGCTCTTCATCAGTCCCAGCCCCAACTTCGTACTTCCTCAAGAACCTTTG
AGCTGGAGTGTTGCCTTGCTTATCAATCGCAGATAGGCTATTTGTGAACCATTCGCGGTTGGTATTTTCCGAGGAGCTCTCGATGCGTGTTAAGAAACAG
TAGAAAGCAGCAGTACGACCGAAAGGAGACGCATAGTCGCGCACTTTGTGTCTGAGTGGGCGTGGTCCTGGTCGCTGATGAGTAAATTGCGAAGTGACGA
GCTGATTGTCGGGTTCATCAATTGCTCGTCTCGATATTACGGTTCCATTTCCCATCATTACGTTAATCTTGGATCCCAAGTATGGATCGTGGAAACCGGA
AGTTTTAGGGTATACGAGTTGACCAGAGTTCTCAAGGGCAACGGTCAAATTACAAACTGACTTGAGACACAGCAGCATTTTAAAGATCTAACCTTAATTC
CTGAAGGCCACCATTTAAGGGCAGGTTACTTGTTTTAGTTATAAAATGTTTCATGTACACACAATAGTGTGAGTTAAGTCGAAGTTTTTGACAGGACCGA
GCCGATTCAGCAAACGATTGTCCATTCAAAACAAAGTTCTTGTGCCCCTATTCCTTTTTTAGATTGCCGAATGTATCGAGAATTGCATTGCGCGTTTTGG
TGACTACAAATAAAAAGACAAAGATCGGCAACACAACAGTGAATTAATTATAATGGAACTACGACATATTTTTAACGAAAACTAACATCGGAAATCTGTT
CAGCATTTGTTATACCCAAGTTTTTGAAATTCCCACTAACTCCTATTATTTTTTAAGATCTGGCAGACTCAACCATTATAGACCAGACGTAAATCGTGAG
GAACAGTTCCTAACTGAAGCTATCGGCTCGTTTTTATTAGT