Description :
From Genome Similarity Track
Location :
scaffold_334:20818- 22801
Transcript NameFunction/comments
Pl_105971cGMP-dependent protein kinase, putative
Pl_105972conserved hypothetical protein

Sequence
1983 bases(100 bases per row)
GCGAATGCGATCATACTCGCTCTTGGACACACCACCGCCCATCGAAAAAGTCTCGGCTGGCAGTCACGTGTAGTCGAAGGAAAAGATTGTTAGGCGTAGA
GCATACCAAACTGAGATTATTCGTTGGGTAGCTAGGTAGGAGTAGACGTCCGACTCGTGCCGAGTTTCATGCACAGGTAGACAGCAATTGAAGCGAAATT
CTTCGCTGTTCGTTGGAATACACTCGCTGCAGGCGACAGAAGTTATTTTCTCCCTTGATGCAGGCTCAGGAAATCGGAGACGAGGGCAACATGCTTCAAA
AATAGGAAGCTAACTAAAGCTTGACAAAGTGTCGGTGGCCTCATTTAGCGCAAGCAAACGTGAACACTTGCAGCAGCTCAAGCTTGAGCTCAAGTGCAAC
AGCTTCAATTCCGACATGGCTACATGTGGACCGGCTTCTTTCTGACTACAAGGCCACGTGATCACGAAAGGGCGCAGGAAGGTCTCCAGTACATACCAGT
CCGCCATGAACTCTGAAGCAACGTGTTGTCACGGCAGTGCCTCGTGTTCGCCTCGTCAAGCAAATGTGAGGATGGAGACGATGCCTTTCGTCGCGAACGA
AAATTGTCGGGCCTAACCCACTGAATTGATCGAGACGAACATATTGGAAAGTGCGTGTTGCAACGAGCACGTGGCGTTCAACTCGAGCCTTCAAGCGTGT
CAAGCGGCCGAAAAATTGGTCGAGTCAGTTGTGTGGCTTGTCCTTGTGGGCTCGCGTTGATGTGTTGGCAAGTTTCCCCTACTACCACGCGGGAGAGAGC
AAACGCTGCGGCTGGAAGCCACACAAGACATGACAATAGAAAGCGGCGTTTCAAGCAAGGTGACTGGAGAGCTCCAAAGAAACTGCAAGTTCGAGACTCT
AGCAACCCACGCAAGCCATTTAGTCACTTTCGAACCGCCATCCACACCACGCAAACCAGTCTTGGAGCTTGGAGCTTGGTGTGCATTCTGGTATTTGGAT
TTGCTTCTCCTTCCCCCAGTTGCCTAACGCGGCAATCAGCAAGTAAGTCGCCGTTGCCTACTCTTTCTCACCTCGTTTATCTAGCACTCACTACATCTGT
CTTGGATGTGCTGCGACATCAACAGCTTCCAGGTCCACCCAGCCGTGGATTGAGAAGCCTCTTCATTCTCCATTTTGCGCCGTAGACAACAAGCAGTTGG
TGTCCATGCGGATCGTAGCTCCTCCTCCCCCTTCTCAGGGTCTTCGTTTCAGTGAATCTGCCATTCCTGAACGCTTCGATCCGTCGTTCCAACTGCCTCC
TAGTGCCAACCGCAGCAGTCTCGCAGCGCTGGACAAACCCACAGGCTTCAACGACCCGTTCGGACTGCGGGACAGCTACACGAGCGAGGCGAGCGGCTTC
GATGTACTCAACTTCTGGACAGTCGAGACGGACCACGACGCGTCCAACAGCCAATTGTTGACCCCCACGGGCTATACAGACCCATACCAAGGCGTGACTA
TCGAGGTGAACAACCACTCCATCAATAACCAAGGTGTAGTCATGTACCACGTGGATATCAAAGGACCTGATGGAATTCTGTCCACTTACACAATCCGTCG
TCGCTTCCGAGCCTTCAAGAACCTCCACAGTGAACTCAGTCGGCTCTTGCTCGAGTATCAGGACTCCAGAGCTCAATTGGAAGCAGCAGTGGCTACTAGA
GCATCGTCGCCACTTGACGGACCTGAGAACCACATTCCGTTGAGTCCACACAGTGCTGCGGCTTTGGTAAAAGCTCCGCCCATATCCAATACAAACTACA
GGACAGTTACGTTCCCTTCGCTGCCTAGTGCAGGAGTCTGGAGTTATCTCAAGCGCCATGACGTGCGGCTCGTTGAGCAACGCAAGAAACGTTTCCAGGA
GATTTTGAGACTCGCTATTCGCCACCCAGCGACCAAGCACAGTAGCGTGCTGGATGAATTCTTGAGTGTCGCTCCCAGTGAAA