Description :
From Genome Similarity Track
Location :
scaffold_43:20808- 21993
Transcript NameFunction/comments
g1884.t1 calcineurin-like phosphoesterase, putative

Sequence
1185 bases(100 bases per row)
CTTAGAAGCGCATATCGTGAACACGGTCGTTCTTGGTCAGAGTGAATTTAGCGTTCAGGTAAGCCCGGAGATAAGGCTCGTTCACCAGCTTTTGCATCAG
CAGGGCGTCCACCGTTTTCTGGTCCTTCTTTCGTTGCTCCGTAATCACAGGTACAGTCTGCGCAAAACGAGAGCCACCGTCAGTTCAACAGGAGGAGGAA
CTTTTGCGATCCCAAGCGCATTTTGCAAACCCCATCGCCACACTTTCGACTCTCACAGGGACTACATAAACACAGGATCCTCGCATAGTGCAGCACGACC
GTAATCAACGTACCGGGGTCTGTTGGGTCGCGAAGAAGCGGTCCTCCTTGCTGCTTTTCTTGGCAGGCTTGTCCTTCGTAAAGTACTCGTCATCGATTTC
CGGCAACTTCACACCCGTCAGGTCCAGTCGGGTGGACGTAGCAATCACAAAAGCCTGGTTCACGCGACGCAGCGGCACACCATTCACCTTGTACGGGCCT
GAAATACACAGACAATATGAATTGTGTTAGCAACATGACTCCTCCAGCGATCTCATCACCTAAAGCCAGCATTCCTCAGGTCTCATAATCTGAAGGATCT
TTGGCACATAGTCCCCCTCCTCCCATCCGCCGCGGCATCCTTCCCGGTGACCCGCGTGCCCCAGGCCGTACATTGTGCAAACCAATCCAGGAGAGCAGGA
ATCAGCACAAGAGCACGAGACGGAGGGGAGCCGCGACAAGATGTAAGAAGAGATGACACAGTGCCTCTCAAAGTGTCAAGTTTGCATCATCGGAATGCCA
GCAGTCGGTAAATATCTGCATGACTCCAGTGTTGACTCACCCGTGACCAGCAGTGTGCCCGACGGCAGCTGCTTGAGGAACACCACGCGTTTGCCCCGAA
AGCGTCCAGACAGCAGGATAAGCACCGTTCCTGGAGTGATAGACTTGCGCAACTTAGCCGTCTTGACGCTATTGCGCTTGGTCTTCGCGGATGGCAGTGG
CTTAGGAATGAAGTCCGCCGGATACCACTGCTTGGTCGAGGACACGGGTTGCGCGGAGGCCTTCTGGGCCTTGGTTTTGCTGTTGGCAGCACTGTGAGCG
AATACTCGACCGTTGGTCTTGGCTAGACTGTTGGCGGAGATCGCGTTGATGCCTCGGGCCAACACAACGTTGGCGCGCTTCTTGG