Description :
From Genome Similarity Track
Location :
Scaffold_107:208055- 209375
Transcript NameFunction/comments
Hyaar_Emoy2809704tryptophan synthase

Sequence
1320 bases(100 bases per row)
CTGCGGCTTCAAGACTAAGGACGATACAGTGGACATTCTGCTCGGACTACAGCGTGGAGGTGCCAATATCATTGAGGTAGGTATCCCGTACTCGGACCCA
CAAGCTGATGGCCCGACCATTCAGCGTGCCCACCAGGTAGGTGTGGACCAGGGCATTACGCTACACGACGTGCTTGATACGGTGAGCGAGGCACGTGGGA
AGGGCCTTACGACTCCCGTCGTGCTGATGGGGTACTACAACAACTTCTTGCAGTACGGTGAGGACAAGATTTGTCCTGATGCTAAGCAAGGTACGGACGT
TGTGGCAGATTTTAGAGAGAGACAGGGATAGAGAGAAGAAGGGGGAGGGGTGGAGATGTGATCGCGTACTTGTCTTGTTTTCCGTATCGTAGCTGGCGTC
GATGGGTTCATCATTGTAGATTTACCGCCAGAGGAGGCCAAGGCGCTCAGCGATGCCGCAGCTACACACGGACTTGCTTACATTCCGCTGGTGTCCCCTA
CGACAACGGACGAGCGGATGAAGCTCATTGACTCGGTGGCGCATGGATTTGTGTACTGCGTGAGTCTCACTGGTGTCACTGGAGCTCGAAACGAGCTGCC
ACCGAACCTGGCCGCGTTCATGAGCAGAAGTGAGTTACTATGTGCACTGTCTGGCTGTAGAGTGCAGTGTGGCTAACTGGAAACATGCGCCTCGTTTTCC
TGTAGTTCGTGCCAATGTGAAGCACCCATTGGCGCTGGGCTTTGGTCTTTCCACCCGCCAGCACTTTGTGCAGGTTAGTGCGTTCGCAGATGGGGTCGTT
ATCGGCTCCAAGATTGTCAAGATCATCGAAGACTCGCCCGATACTGCCAGTCGGGCTGCCAACGTCGAGGCGTTTGCCAAGAGTATCGTCAATCCGTAGG
GTAGGCCTGCTTGCTGCGAACTTACTTGACCGTAGAAAATCTACCGGGTGGGTGGTGATAAACTGCTATTTCAATTGAACTAAAACGCGTTGGCAGACTT
TGTGTCTAGTAATATAAGTTCACACGATCTGTCATATATGTATATTTAGTTGTAATAACTGGTCGCTATGTGTAACGAGATCGTTGGATGGCGTGGGTTC
GAGTCCCTATGGGTAGAGGTCGGGAGGGTAGAAAAGGGGTACATTAATATAGCACGCTTCGAAGCCCGATGTGTCTGTACCATTAGACTAAGGATCGGGT
CAAAACGTGTGCGATAGCAGCAATCGTGTGTCAGGGTGTCAGGACTGGGTGATGTACCAACAGGTACCGAAATCTCAAAACCTGCCAATCGACATACAGA
CATTCTTTTCTCGAAACGAA