Description :
From Genome Similarity Track
Location :
contig_59:208041- 210275
Transcript NameFunction/comments
g10620.t1hypothetical protein

Sequence
2234 bases(100 bases per row)
CCAAGTCTCCTGCGGACACCGTGTCCACGAACGACAGCTCCGCGGGTGGCCAGAAGGACGGCGATGCTAAGGCAGCGTCGCCAGCCAAGCGCTTGACGCT
CGGCGAGGGTCTCCAGCGAGCCCGTGACGCCAAGGCTAAAGAGGCCGGGTCGAAGAAGCGAATCGCTTCTCGGTCCCCTCCCAAGGGCCGGACTAGGGGG
CTTGATGTTATCAAGTCCCTGTTTGACTCCTCGGAGTCGAACTCGGAGGATGAAGAGGGACAGGTACATGTCCCGGAGGAGGTCGCTAATGCGCTCGACG
AGCAACAGGAACGCCTCCAGGAGGCCCGGATGCGCCAGTGCCTCCCGCCTCCGACGCCGCAGCCAACTCCTGGCGGGGGTGCTTCGGGAGAGAGGGAAGT
CCAAGTACCCCAGGGGCTACTTCCCGCCCGATGAGAACACGGGTTCTCCGTTGTTTCTTGAGAGGCTCGGCGCCCCTCGTGGCCTCCCGAGGCGCGTATG
AGCGCGACTTGATCCAAAAGGTGGACTTGTTCACCGAGGATATTGAGGCCGCTCGGTGTGTGGCGAAGCGGGATCACGAAAATTGCTGTCGCGATCCCAG
ACTTACCAGCGGTACGCCCGGACTGCCGACTGTCGGAGGGGGTACTCCGTTGATCTGGCGTGATCGGAACCTTGTATTCACCTTGTGTACCCGACGGCGG
GGCGGGTTACGCTCTTCCGGTGTTCACTGAAGGCGTCGGTGGTTACCAAGACGGGGTGGGGAGCTGGACGGCTCCTTCCGGGGAACTGGGTGGCAACGGC
CACGTGGGTATTCTTCACGCGGTCGTCGGTGGTCTGCCGATCGGGGCCTGGTTGGGCTTGATCGGCGTGGGGGGGGGGGGGGGTTCCTTTACGTGCTTGC
CGCCTCCTATGGCGGGGTCTTCTGGGGGGAGTTAAGTGGTTGCGCACCTGGCCAAGCGATTCAGGGGCTCCCGTGTAATTACCGTGCGCGACGAGGTGAG
TCCGGAGTCGTCAGGAGGGCCAATATACTTCCCAGCCTGGAATCAACGAACGCCACTTGTGTTGCAAGGGAAAGCTTCTTCTTCTCAAATTAAGCAAAAC
AAACAAACAAAGATCTCAGCTTCCTATCCTTCCTCCCCTTACTGGATTCTTTCACCCATCTCCCGAGGTACCTTCCGCGGATCCTTACTCCGGAATGATT
GCGGGTGTACCACCAAAATGGTACGCCACGATCGTCATTTGTGATCGGGATCGCGATCGCAGTTGGGACCACGATCGCATACCGAAATGATCGCACCATA
CCGCATACCGGTATACACCGATGACTGATGGCGCCTCTGTACCCATCGGGTCTCCATACCCCTACCCCTCAGGTCCAATCTAATCCCTCCAAAGTCGGTC
CTCATCAACCTCCGATCGTACGTCCGGTCCCGTCCGATCCTAGCCCATCGTTGGTCCATCACGAAATTTCCAACATCCACTTCACCACAATTGCCCCCTG
TACACGCCGTGGCTGCACAACAGTACACTCGTCACTTCTCCTTCTCGCTCCTCGCCACCACACCTCCACATCACCATATCAGGCAACTCCTCGCCGGATC
AGAGAGATTCCACGAGCGATCCTTCTCCTCATTCGCCCACGTCAGCTTCCTCTCGATCTCCTTCGTCGCAGCAGAGGGCTACGACCTCGGACCCGTCCGC
CGCAGTTCCTGTAACCTCGGATGCCACCGTAACAACTCCCTCGGCTTTCTCCGGACATGTACAACGAATCGAAGGTCAACCTGGCGATCTTCCGACCGAG
CCGTTGACCCAAGCTGATCCCACGTTGCCGCCCCTGGACCAGACCACCATCCGGAGATCGTTGGCTGCAGTTGAAGCCGCTCTGGATCGCGAGGGTGCGT
TTCAGGCACTCCAGCGTAGCTACGACGATCTGTTACGATATTACTTCGCTTTGCGGCAGCGTGCGGCAGACCTGGAGCACACTATTCGGTCGGCCGCTCA
ATCAGCGTCCCCATTCGTCTGCTTCGTCCAACAGAAGTACGACCAGTTGTCTCATCGTCTCGCGCAGTCCACCTTGGACTTGGCGGAAACCCGGGAAGCT
CTGGCCCAGAGACTCGATAATGCGACTGAACTTACCAACCTCCGCGATCGCATGCGCTTCCAAGATCGCGTACACGCAGAAGCTGTCGCTGACTTCCAAA
GGGAAATCGACGATTTGGAGCGGCGTCTAACAGC