Description :
From Genome Similarity Track
Location :
contig_4:208032- 210084
Transcript NameFunction/comments
g1231.t1hypothetical protein
g1232.t1hypothetical protein

Sequence
2052 bases(100 bases per row)
AAGCACAAAAAGCTGCTTCTCGGGTTGGCCCAGTTCGCATTTTGAGGCCTCCTAGAGAGAAATTCCGACGCATCCTGTTTTATCTGGTCAAGATGCAGCG
CTTCGAATGGTTCATCATGATATGCATCATCGTGAACACGTTTCTCATGGCTGCTCAATACTTTGGACAATCTACGCTGCAAGCCTACGCCATTAATATT
ATAAACGAGATCTTCGCGGTGATCTTCACAGTGGAAGCTTTGTTCAAGCTGACAGCGTTCGGGTGGGAGTATTTCGAAGACCAGTGGAACCAATTCGACT
TTTTTGTGGTACTGGGGACACTGCTGAGCGTTGTGGTGGAGCTGTTTACCGGAGCTTCCGTTCGATCACTCGCTATGCTGGTGCGTGTTTTTCGAGTCAC
ACGTATTCTGCGGTTGGTCAAAGCATCGAAAAGCATCCGACAGATTCTACTGACGCTGTACATTGCTCTTCCGGGTCTCAGCAATATCACATCCATCCTG
TTTTTGATGTTGTTTATCTACTCGACCATGGGGGTTCAGATCTTCGCCAAAGTCGCGCTGTCAGACAACATCGACAGTCACGCCAACTTCCAGGATTTTG
GTAATGGATTCCTCTTCTTGCTTCGCGCTGCAACAGGTGAAGCCTGGAACAGCTGCATGCATGACCTAGCGTCGAGTACAGCAGGCTGCGTGGATGACCC
GCCCTACGATCCAAACATGTGCGGTTTTAACACCTTCGACGGATGCGTACCTTTGAACGGTTGCGGAAACCCAATCGCCTACGCTTTCTTCTGCACCTTC
ACATTGCTGGTGACGTACGTCATGCTCAACCTCACGATCGCCGTTATCCTCGAGGGTTTCTCTTTATCGCATGAAGACGAAGAACCGTTGTTTGAGCCAG
AGATTCTTGATGAGTTCCAGACTAAGTGGGCTGACATCGATCCTAAAGCCACTGGGTTCGTCAAGGTCGACAAAATGCTGCTGCTCGTGAACCTGCTTAG
ACCACCTCTGGGGAAGCATGGAGTCCCCTTCGATATGGCTCACTTCTTCAAGTACATGTGTACGTTTCGCGACTGCCGTGGCAACCATCTCGTCCTCCTT
TCTAACACATTTGTGGGTTTGCAGGCCAACTCAAGGTCCCTCTATACGAAGACGAATACGTCCATTTCCGCGACGTGCTGCTTGCCATGACCCGGGAAAT
GGTCAAAGTACGTTTGCTCTTGACAATGCTGTAGAAACGTCCTCCCCACTAACGTGTCCACTGCAGCTCAACGCAGGCACCATCTCCGATATGCCAGCTG
ATCAGGACGTCACGAACGGGGGCGTCCCTGGCGCGAAGCGGCGCATCGAGTTCTTGGCGCACCAATACTTCGGCGCGCGCCGCATCCAGCGCCAAGTGGC
TCAGTGGCTGCGCATCAAACGGCAGCTCGAGAAGAAGTACATGGAAGAGTACAAGAACAAGATCAAGAAGCCCAGCGGCCGCCCCAGAAAGCAGCGCGAC
GCACGCGTTTTCACCATAGGATAGCTACAAATTCTACAACCCACGGTCGTCTCGTCCCCTTAAAAGAAACACAAAGGACAAAAGTCTCGTTTTCGCTGAA
TTACCGTCGACTGACACGGCGGCCTCCACGTCGGTCCGCGTCCTTACGGAAGGCCCAATCCACCTGGATCGTACTGCCCAGGATTTCCTGGCCGTCCATG
CGCTCCATGGCCGCCTTGGCGTCCTCGAAGCTCTCAAACTTGACAAGCGCGTAGCCCTTGACGAAGCCTGAGCGGCGGTCCAAGTTCAGGTGCAGGTCCT
TCACCTGCGCGTCCTCCGCGAAGGCGTCCATGACGTCCTCCTCCTGCGCCTCTTCGTGCACGCCCGTGACGAAGAGCAGCCAGCCTTCCACGGACTGCAG
CGCTGTCGAGTGGTCCCTGGGTGACGCCTGGAGCTTCTCGAACACGCCGCTCTCGGCCGGGTAGCGGTTCGAGTCCATCGCCGCGGATCCGGCGCCGCGT
CCCTTTACCACGCGCGGCTTGTCCTCCTCTTCCTCCACGGCCATGGCCGTGT