Description :
From Genome Similarity Track
Location :
contig_118:20803- 22088
Transcript NameFunction/comments
g11305.t1hypothetical protein

Sequence
1285 bases(100 bases per row)
TCACTTTTCAACTTGCACTCAAGCGCCATGGCCCCATCAACATCGACTCCACCTCCACCACTGCCGGACCCACTGCCGCGGTGGTAGTCACACCAATCAA
GAACGCGCTCAACCAAGAGGTCGAACATGCACCCTTCACCCACCCGGAGCTGCTCGGAGAGTTCCCCACCAAGACGTACGATCCGATCCCCGTGCTGCCG
TACAACGACCGCGCGCTCAAGGCCGATCCGTCGTTCAAGAACCTGCTCGCGGATGCGACGGTGACGCACCTGGAGCCGAAGATTGGCACGGAGATCTCGG
GTCTGCAGCTGCACGAGCTGACGGACGCGCAGAAGGACGAGCTGGCGCTGCTGGTGGCGCAGCGCGGCGTGGTGTTCTTCCGCGAGCAGGAGATCTCGAT
CGAGCAGCAGTTGGATCTGGGTCGCTACTACGGTCCTCTGCACGTGCACCAGACGGTGGCTCACGCGAAGAGTATCCCGCAGGTGCACGTGGTGGAGAAC
TCACTCGAAGTTAGCGAGAAGCGTATCAAGTCGCAACTGTATGATCATGTGAATGTGTGGCACAGTGATGTGTCCTATGAGCGCCAGGTGAAGAAGTTTG
GGGGGGGGGGTATGTTCTGTACATGTTTAGTATATTAACTTGTGTGACTTGTAGCCTCCATCCTACACGAGTTTCAAGGTCTTGACTACACCACCCACGG
GTGGAGACACGCTGTGGGCGTCTGCGTACGACGCGTACGAGCGTCTTACCCCACCGTTCAAGATATTAGTTGAAGGACTGACCGCCATTCACAGCAGCAA
GGTACGAGCACTTTACCCGCTTGCTTACGGGGAAAGCTAGTGTACTGATTGATTATTGACGCAGCATCAAGCTGAGGCCGCTATCGCTCAGGGTCTGACC
CTGCGCCGCCCAATTGTTGAGTTCGAGCACCCCGTTGTCCGCACCCACCCTGTCACTGGCCGTAAGGCCTTGTTTGTGAACGACCAATTCACGACTCGCA
TCAAGAACCTCTCGGTGGCCGAGTCTGGTACGATATTTAGTCGTATTGATTCCAGTAGAAAGCTATGACACTGATTTGTGTGGGTGTGTTTACAGACGCG
GTGCTGCACTTCCTGATTAAACACATCGCGGAAGGTCACGAGTTCCAAGTGCGCTACCACTGGACTAAGGACTCCGTGGCCATTTGGGACAACCGAGCCA
CGATCCACTACGCCACGTACGACTACCTGCCTGGCAACCGCCACGCTGTGCGTGTGACGCCTCATGGCGAGATCCCGTACTTCGA