Description :
From Genome Similarity Track
Location :
contig_59:208021- 210254
Transcript NameFunction/comments
g11085.t1hypothetical protein
g11086.t1hypothetical protein

Sequence
2233 bases(100 bases per row)
TGGGGACAACGTGCCCAAGTCTCCTGCGGACACTGTGTCCACGAATGACAGCGCCGCGGGTGGCCAGAAGGACGGCAACGCTAAGGCAACGTCGCCAGCC
AAGCGCTTGACGCTCGGCGAGGGTCTCCAGCGAGCCCGTGACGCCAAGGCCAAAAAGGCCGGGTCGAAGAAGCGAATCGCTTCTCGGTCCCCTCCCAAGG
GCCGGACTAGGGGGCTTGATGTTATCAAATCCCTGTTTGAGTCCTCGGAGTCGAACTTGGAGGATGAAGAGGGATAGGTACATGTCCCGGAGGAGGTCGC
TAATGCGCTCGACGAGCAGCAAGAACGCCTCCAGGAGGCCCGGATGCGCCAGTGCCTCCCGCCTCCGACGCCGCAGCCAACTCCTGGCGGGGGTGCTTCG
GGAGAGAGGGAAGTCCAAGTACCCCAGGGGCTACTTCCCGCCCGATGAGAACACGGGTTCTCCGTTGTTTCTTGAGAGGCTCGGCGCCCCTCGTGGCCTC
CCGAGGCGCGTATGAGCGCGACTTGATCCAAAAGGTGGACTTGTTCACCGAGGATATTGAGGCCGCTCGGTGTGTGGCGAAGCGGGATCACGAAAATTGC
TGTCGCGATCCCAGACTTACCAGCGGTACGCCCGGACTGCCGACTGTCGGAGGGGGTACTCCGTTGATCTGGCGTGATCGGAACCTTGTATTCACCTTGT
GTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCACTAAAGGCGTCGGTGGTTACCAAGACGGGGTGGGGAGCTGGACGGCTCCTTCCGGGGAAC
TGGGTGGCAACGGCCACGTGGGTATTCTTCACGCGGTCGTCGGTGGTCTGCCGATCGGGGCCTGGTTGGGCTTGATCGGCGTGGGGGGGGGGGGGGGTTC
CTTTACGTGCTTGCCGCCTCCTATGGCGGGGTCTTCTGGGGGGAGTTAAGTGGTTGCGCATCTGGCCAAGCGATCCAGGGGCTCCCGTGTAATTACCGTG
CGCGACGAGATGAGTCCGGAGTCGTCAGGAGGGCCAATATACTTCCCAGCCTGGAATCAACGAACGCCACTTGTGTTGCAAGGGAAAGCTTCTTCTTCTC
AAATTAAGCAAAACAAACAAACAAAGATCTCAGCTTCCTATCCTTCCTCCCCTTACTGGATTCTTTCACCCATCTCCCGAGGTACCTTCCGCGGATCCTT
ACTCCGGAATGATTGCGGGTGTACCACCAAAATGGTACGCCACGATCGTCATTTGTGATCGGGATCGCGATCGCAGTTGGGACCACGATCGCATACCGAA
ATGATCGCACCATACCGCATACCGGTATACACCGATGACTGATGGCGCCTCTGTACCCATCGGGTCTCCATACCCCTACCCCTCAGGTCCAATCTAATCC
CTCCAAAGTCGGTCCTCATCAACCTCCGATCGTACGTCCGGTCCCGTCCGATCCTAGCCCATCGTTGGTCCATCACGAAATTTCAACATCCACTTCACCA
CAATTGCCCCTTGTACACGCCGTGGCTGCACAACAGTCTTGGCGTGCACACTCGTCACTTCTCCTTCTCGCTCCTCGCCACCACACCTCCACAGCACCAT
GTCAGGCAACTCCTCGCCGGATCAGAGAGATTCCACGAGCGATCCTTCTCCTCATTCGCCCACGTCAGCTTCCTCTCGATCTCCTTCGCCGCAGCAGAGG
GCTACGACCTCGGACCCGTCCGCCGCAGTTCCTGTAACCTCGGATGCCACCGTAACAACTCCCTCGGCTTTCTCCGGACATGTACAACGAATCGAAGGTC
AACCTGGCGATCTTCCGACCGAGCCGTTGACCCAAGCTGATCCCACGTTGCCGCCCCTGGACCAGACCACCATCCGGAGATCGTTGGCTGCAGTTGAAGC
CGCTCTGGATCGCGAGGGTGCGTTTCAGGCACTCCAGCGTAGCTACGACGATCTGTTACGATCTTACTTCGCTTTGCGGCAGACCTGGAGCACACCATTC
GGTCGGCCGCTCAATCAGCGTCCCCATTCGTCTGCTTCGTCCAACAGAAGTACGATCAGCTGTCCCATCGTCTCGCGCAGTCCACCTTGGACTTGGCGGA
AACCCGGGAAGCTGTGGCCCAGAGACTCGACAATGCGACTGAACTTACCAACCTCCGTGATCGTATGCGCTTCCAAGAGCGCGTACACGCAGAAGCTGTC
GCTGACTTCCAAAGGGAAATCGACGATTTGGAG