Description :
From Genome Similarity Track
Location :
contig_4:208016- 211090
Transcript NameFunction/comments
g1231.t1hypothetical protein
g1232.t1hypothetical protein
g1233.t1XP_008898579.1 hypothetical protein PPTG_06415 [Phytophthora parasitica INRA-310

Sequence
3074 bases(100 bases per row)
CAGAAGAAGTGGATCGAAGCACAAAAAGCTGCTTCTCGGGTTGGCCCAGTTCGCATTTTGAGGCCTCCTAGAGAGAAATTCCGACGCATCCTGTTTTATC
TGGTCAAGATGCAGCGCTTCGAATGGTTCATCATGATATGCATCATCGTGAACACGTTTCTCATGGCTGCTCAATACTTTGGACAATCTACGCTGCAAGC
CTACGCCATTAATATTATAAACGAGATCTTCGCGGTGATCTTCACAGTGGAAGCTTTGTTCAAGCTGACAGCGTTCGGGTGGGAGTATTTCGAAGACCAG
TGGAACCAATTCGACTTTTTTGTGGTACTGGGGACACTGCTGAGCGTTGTGGTGGAGCTGTTTACCGGAGCTTCCGTTCGATCACTCGCTATGCTGGTGC
GTGTTTTTCGAGTCACACGTATTCTGCGGTTGGTCAAAGCATCGAAAAGCATCCGACAGATTCTACTGACGCTGTACATTGCTCTTCCGGGTCTCAGCAA
TATCACATCCATCCTGTTTTTGATGTTGTTTATCTACTCGACCATGGGGGTTCAGATCTTCGCCAAAGTCGCGCTGTCAGACAACATCGACAGTCACGCC
AACTTCCAGGATTTTGGTAATGGATTCCTCTTCTTGCTTCGCGCTGCAACAGGTGAAGCCTGGAACAGCTGCATGCATGACCTAGCGTCGAGTACAGCAG
GCTGCGTGGATGACCCGCCCTACGATCCAAACATGTGCGGTTTTAACACCTTCGACGGATGCGTACCTTTGAACGGTTGCGGAAACCCAATCGCCTACGC
TTTCTTCTGCACCTTCACATTGCTGGTGACGTACGTCATGCTCAACCTCACGATCGCCGTTATCCTCGAGGGTTTCTCTTTATCGCATGAAGACGAAGAA
CCGTTGTTTGAGCCAGAGATTCTTGATGAGTTCCAGACTAAGTGGGCTGACATCGATCCTAAAGCCACTGGGTTCGTCAAGGTCGACAAAATGCTGCTGC
TCGTGAACCTGCTTAGACCACCTCTGGGGAAGCATGGAGTCCCCTTCGATATGGCTCACTTCTTCAAGTACATGTGTACGTTTCGCGACTGCCGTGGCAA
CCATCTCGTCCTCCTTTCTAACACATTTGTGGGTTTGCAGGCCAACTCAAGGTCCCTCTATACGAAGACGAATACGTCCATTTCCGCGACGTGCTGCTTG
CCATGACCCGGGAAATGGTCAAAGTACGTTTGCTCTTGACAATGCTGTAGAAACGTCCTCCCCACTAACGTGTCCACTGCAGCTCAACGCAGGCACCATC
TCCGATATGCCAGCTGATCAGGACGTCACGAACGGGGGCGTCCCTGGCGCGAAGCGGCGCATCGAGTTCTTGGCGCACCAATACTTCGGCGCGCGCCGCA
TCCAGCGCCAAGTGGCTCAGTGGCTGCGCATCAAACGGCAGCTCGAGAAGAAGTACATGGAAGAGTACAAGAACAAGATCAAGAAGCCCAGCGGCCGCCC
CAGAAAGCAGCGCGACGCACGCGTTTTCACCATAGGATAGCTACAAATTCTACAACCCACGGTCGTCTCGTCCCCTTAAAAGAAACACAAAGGACAAAAG
TCTCGTTTTCGCTGAATTACCGTCGACTGACACGGCGGCCTCCACGTCGGTCCGCGTCCTTACGGAAGGCCCAATCCACCTGGATCGTACTGCCCAGGAT
TTCCTGGCCGTCCATGCGCTCCATGGCCGCCTTGGCGTCCTCGAAGCTCTCAAACTTGACAAGCGCGTAGCCCTTGACGAAGCCTGAGCGGCGGTCCAAG
TTCAGGTGCAGGTCCTTCACCTGCGCGTCCTCCGCGAAGGCGTCCATGACGTCCTCCTCCTGCGCCTCTTCGTGCACGCCCGTGACGAAGAGCAGCCAGC
CTTCCACGGACTGCAGCGCTGTCGAGTGGTCCCTGGGTGACGCCTGGAGCTTCTCGAACACGCCGCTCTCGGCCGGGTAGCGGTTCGAGTCCATCGCCGC
GGATCCGGCGCCGCGTCCCTTTACCACGCGCGGCTTGTCCTCCTCTTCCTCCACGGCCATGGCCGTGTCGCTCTCGTAGTCCACCTCGTCCGCCATGGTA
GTTGGATTGTGGTTGGAGCTTATTGGCGCTGCTCTTGTTAAGTACGATATTGGATAGATACATGTAGCCATGTTGAGAGATTTTGAGACGGATACATGCA
GCCATGATGAAAGGCAACTTGTGTCGCTAGTTAAATACTTCCGAGGAAGCGGGGGAGCTGACGCATGGATACGTGGTGGCTGCAGGGAGTTCAGACGTTT
CTCGAGGAGCGGAAGCGGTGTAAGGAACGCTGCAGCGGCTCGCCGTCGTGCAGGGCCTCGAGGATCTTGTTGTCCTGGTCCTCGATGATTTCCGCCTTGG
TCGCGATGTCTTCTGCACGCTCGGCCGGGATCACGAGCACGCCGTTGATGTCTCCGCGGATGATGTCGTTCTGGCGCACCACGCAGCCAGCCACCACCAC
GGGGCAGTTCACGTCGGCGATGGTCGTTGAGCCGTACTCGCCGTGCACTGACGTCCCCGTTGCAAACGCCGGGAAATGTTCATCGTGCAGAGCTCCTGCA
CGTCTCGCACGCACCCGTCCGTGACGACACCGGCCACACTTCGCGTCTTGGACGCCGTAGCGAGCAGTCCACCAAACACAGCCGACCTGACCCCCGTCGG
GGCGCTGATTACCACCACCTGCCCCATCTCGGCCGTGTCCATGTAGTCGTACGAGCCGTCGCCGTTCATCGCGCCCGTGATCGGCATCATCTTGACCGTG
AGCGCCGGTCCGCAGATGTTCATGGCCAACGGGGCGTCATACCCGCGCACGAGGTTCACATCCAGCAAATGTCCCTGGATCTTCATCTGCGCCATGGCGT
CTGCGATGACACACGTGGAGAGTTTGGCCAGGCGGAGCAACACTTCCGATAGGTCCAGCGGCTCCCCCTCGGCCTCCAGCATGTTGGACAGCAGCTGCTG
CTCGGACCGTCTCAGAGCCAGCGACTGGGCCGTCTCCACCCCCGCGTTTGCGTACACGTCCGCGTTGGCGGTGG