Description :
From Genome Similarity Track
Location :
contig_4:208015- 211089
Transcript NameFunction/comments
g1331.t1hypothetical protein
g1332.t1hypothetical protein
g1333.t1XP_008898579.1 hypothetical protein PPTG_06415 [Phytophthora parasitica INRA-310

Sequence
3074 bases(100 bases per row)
ACACCAGAACAGAAGAAGTGGATCGAAGCACAAAAAGCTGCTTCTCGGGTTGGCCCAGTTCGCATTTTGAGACCTCCTAGAGAGAAATTCCGGCGCATCC
TGTTTTATCTCGTCAAGATGCAGCGCTTCGAATGGTTCATCATGATATGCATCATCGTGAACACGTTTCTCATGGCTGCTCAATACTTTGGACAATCTAC
GCTGCAAGCCTACGCCATTAATATTATAAACGAGATCTTCGCGGTGATCTTCACAGTGGAAGCTTTGTTCAAGCTGACAGCGTTCGGGTGGGAGTATTTC
GAAGACCAGTGGAACCAATTCGACTTTTTTGTGGTACTGGGGACACTGCTGAGCGTTGTGGTGGAGCTGTTTACCGGAGCTTCCGTTCGATCACTCGCTA
TGCTGGTGCGTGTTTTTCGAGTCACACGTATTCTGCGGTTGGTCAAAGCATCGAAAAGCATCCGACAGATTCTACTGACGCTGTACATTGCTCTTCCGGG
TCTCAGCAATATCACATCCATCCTGTTTTTGATGTTGTTTATCTACTCGACCATGGGGGTTCAGATCTTCGCCAAAGTCGCGCTGTCAGACAACATCGAC
AGTCACGCCAACTTCCAGGATTTTGGTAATGGATTCCTCTTCTTGCTTCGCGCTGCAACAGGTGAAGCTTGGAACAGCTGCATGCATGACCTAGCGTCGA
GTACAGCAGGCTGCGTGGATGACCCGCCCTACGATCCAAACATGTGCGGTTTTAACACCTTCGACGGATGCGTACCTTTGAACGGTTGCGGAAACCCAAT
CGCCTACGCTTTCTTCTGCACCTTCACATTGCTGGTGACGTACGTCATGCTCAACCTCACGATCGCCGTTATCCTCGAGGGTTTCTCTTTATCGCATGAA
GACGAAGAACCGTTGTTTGAGCCAGAGATTCTTGATGAGTTCCAGACTAAGTGGGCTGACATCGATCCTAAAGCCACTGGGTTCGTCAAGGTCGACAAAA
TGCTGCTGCTCGTGAACCTGCTTAGACCACCTCTGGGGAAGCATGGAGTCCCCTTCGATATGGCTCACTTCTTCAAGTACATGTGTACGTTTCGCGACTG
CCGTGGCAACCATCTCGTCCTCCTTTCTAACACATTTGTGGGTTTGCAGGCCAACTCAAGGTCCCTCTATACGAAGACGAATACGTCCATTTCCGCGACG
TGCTGCTTGCCATGACCCGGGAAATGGTCAAAGTACGTTTGCTCTTGACAATGCTGTAGAAACGTCCTCCCCACTAACGTGTCCACTGCAGCTCAACGCA
GGCACCATCTCCGATATGCCAGCTGATCAGGACGTCACGAACGGGGGCGTCCCTGGCGCGAAGCGGCGCATCGAGTTCTTGGCGCACCAATACTTCGGCG
CGCGCCGCATCCAGCGCCAAGTGGCTCAGTGGCTGCGCATCAAACGGCAGCTCGAGAAGAAGTACATGGAAGAGTACAAGAACAAGATCAAGAAGCCCAG
CGGCCGCCCCAGAAAGCAGCGCGACGCACGCGTTTTCACCATAGGATAGCTACAAATTCTACAACCCACGGTCGTCTCGTCCCCTTAAAAGAAACACAAA
GGACAAAAGTCTCGTTTTCGCTGAATTACCGTCGACTGACACGGCGGCCTCCACGTCGGTCCGCGTCCTTACGGAAGGCCCAATCCACCTGGATCGTACT
GCCCAGGATTTCCTGGCCGTCCATGCGCTCCATGGCCGCCTTGGCGTCCTCGAAGCTCTCAAACTTGACAAGCGCGTAGCCCTTGACGAAGCCTGAGCGG
CGGTCCAAGTTCAGGTGCAGGTCCTTCACCTGCGCGTCCTCCGCGAAGGCGTCCATGACGTCCTCCTCCTGCGCCTCTTCGTGCACGCCCGTGACGAAGA
GCAGCCAGCCTTCCACGGACTGCAGCGCTGTCGAGTGGTCCCTGGGTGACGCCTGGAGCTTCTCGAACACGCCGCTCTCGGCCGGGTAGCGGTTCGAGTC
CATCGCCGCGGATCCGGCGCCGCGTCCCTTTACCACGCGCGGCTTGTCCTCCTCTTCCTCCACGGCCATGGCCGTGTCGCTCTCGTAGTCCACCTCGTCC
GCCATGGTAGTTGGATTGTGGTTGGAGCTTATTGGCGCTGCTCTTGTTAAGTACGATATTGGATAGATACATGTAGCCATGTTGAGAGATTTTGAGACGG
ATACATGCAGCCATGATGAAAGGCAACTTGTGTCGCTAGTTAAATACTTCCGAGGAAGCGGGGGAGCTGACGCATGGATACGTGGTGGCTGCAGGGAGTT
CAGACGTTTCTCGAGGAGCGGAAGCGGTGTAAGGAACGCTGCAGCGGCTCGCCGTCGTGCAGGGCCTCGAGGATCTTGTTGTCCTGGTCCTCGATGATTT
CCGCCTTGGTCGCGATGTCTTCTGCACGCTCGGCCGGGATCACGAGCACGCCGTTGATGTCTCCGCGGATGATGTCGTTCTGGCGCACCACGCAGCCAGC
CACCACCACGGGGCAGTTCACGTCGGCGATGGTCGTTGAGCCGTACTCGCCGTGCACTGACGTCCCCGTTGCAAACGCCGGGAAATGTTCATCGTGCAGA
GCTCCTGCACGTCTCGCACGCACCCGTCCGTGACGACACCGGCCACACTTCGCGTCTTGGACGCCGTAGCGAGCAGTCCACCAAACACAGCCGACCTGAC
CCCCGTCGGGGCGCTGATTACCACCACCTGCCCCATCTCGGCCGTGTCCATGTAGTCGTACGAGCCGTCGCCGTTCATCGCGCCCGTGATCGGCATCATC
TTGACCGTGAGCGCCGGTCCGCAGATGTTCATGGCCAACGGGGCGTCATACCCGCGCACGAGGTTCACATCCAGCAAATGTCCCTGGATCTTCATCTGCG
CCATGGCGTCTGCGATGACACACGTGGAGAGTTTGGCCAGGCGGAGCAACACTTCCGATAGGTCCAGCGGCTCCCCCTCGGCCTCCAGCATGTTGGACAG
CAGCTGCTGCTCGGACCGTCTCAGAGCCAGCGACTGGGCCGTCTCCACCCCCGCGTTTGCGTACACGTCCGCGT