Description :
From Genome Similarity Track
Location :
Scaffold_13:208010- 211308
Transcript NameFunction/comments
g18346.t1hypothetical protein

Sequence
3298 bases(100 bases per row)
CAAGATGCTCGAGTTCCCCTTGCACGACGGCTTTTTCCCGCAAATCGCGCTAAGCCGAGAGGAGGTCAAGTACTACAAGCGCCTGGGCAAGGAGCGCGTT
GCGCAGCTCGTGCGAATCATCGAGGACGCCGACTGCGCGTACAAATGGACCAATGCCTCGTCCTCCAGCTCGCGGCGGCTGCGCCTCGAGCCCAAGAGCG
GCGTCACGTGCCAGCGCGCCAACTTCCTCGACTTCCAGCCGGCCAACAAGGCGGCGCACGCATCTACGCTGCTCAAGGCCAGCGTGCAACTCTCGGACAC
GCGCGTGGACGAGATTTTGCGCGCCATCGCAAAAGTCAAAACCAAGGATTTGCGCAAAACGCTGCGCTACATGCACGGTGACGCGTTCGTGGACGGCCGC
ACGCTCTTCACGTTCCCCACTTCCAGCGCTGCAACAGGCAGCGAAACGTCGCACAGTCGCGCGAAATCTTCGTATCGCGCCATTAAATGGCACGCGTTTA
AGACACAACGCCCGCGCCACGGCGAAGAGCAAAAAATCCTGGATTTTTGCTACTTGGAGTACGCCGGCAAGAAGAAACCCCACCCCGGGTCCAATGTCGT
GGCCTTTTGCGTGCAAGAGTCCATCTCCCGGGACCGCGAAGTGCCCACGCTCGAGAATTTCGGCGTTGCGCGCGGGTATTTGTCGCGCATGGGGCTCATT
GTGTCGCAAACGCACCAACCGAACACGTTTCGCGTGACATCCATTTGCCAAATCGACGGCGACCTAAACCCTATTGTGCGAAACGTGCTGGAAGAGCTCA
TGAAGCAGACGGTTTGCGCAGTTGCGCAAATTCCGGGTCTTGTGGCGCGGCAGAGGGTGAGCAGCTTGCGCTTCGTGGAGCAGTGGCAATGGGTGCCCAA
CTCGGACCGCAAAGCCTGCGCGGTTTGTTTGCGCGGCTTTTACTTCCGCCGCAAACACCACTGCCGAACATGCGGAGAGGTGGTGTGCTCGAGTTGCGCG
CTGCTGCGCGAATTGGAGGAGCCGATTTTCGACATTTCGCGTTTGCGCGTGTGCTCCGCGTGCATGACGAGCGCGGGTGCGCGGCAGCAGCTTTCGGCGC
TCAGCGCAACAGGAGATGAGCCCGTGTCGTCGTCCAATGACACGGAGTCGTACATTCGCGGCTTGCGCAGTCCGCAGCACAATTCGTACGAAGACATGGT
CTTCCACATGCGCGAATCGCGCGACCGCGACCGGCGCCAGAGCGATTTGGCAATGGATGTTTTGGAGTCATCCGACACCGAGCTCAAACCTGTTGCGCAA
AAGTGCAAAAGCCCGAATTTGCGCAATCAGGACAAGTTGCAGGCGCTCACAGATGTGGTGACTCACATTCGCGAGGTTAGGGAGACCATCAACCTCACTA
TGTCCGAGGCTGCCTATGCAGAAAATGACAGTGGCGAGGAGGAATTTAACGATATGTACAGCGAAATCACGAGTATTCGCGAAGCACTGGAGAGTTCAGT
CTCAAATTTTGACGCTGCACTGGCAAATACGACCAATGCGGCACCTGCCATGTATTATTCCGGACCAAGCGACCGCAGTCAGAACTCGCTGCACAGCGAG
CAGGACGACATGACGCCGGACCAGTTCATCTCAGTGGCGCGAATCACGTTCGCAGCTGCACGAGCCACGAGCCAAGCCGGGCAGGCCTTCCTCTCGACGT
TTTCGGATACCGGCCCGGAGCTTTTGCGCGAAAATGACGAAAATTCGGTGGCGAGTTACCCGACGATTTATGACAGCGACGACAGTTTGGCGCAAAGCCC
CGACCCGTACTCTGCGTCGAATTACGAGAAACTCATGGCCACGTATGAGCCGGAGCACGACGAGTCTGAACAGGAAGAGGAAACGCACAATTTCCCCACT
TCCGTGCGCCGCGCGACCGAAATCCATGAACTGGAGAAGAAAATCCGCGACCTGCAGCGCAGTCTAGAGGACGCGCAACGGAAGCTGTCGGTTATCGACA
GCGACGAGCCCGAGCCGGAAGCGAGGTCGCGGCGCCTCGATGCCGTGCAGGAGCGCTCGGCGCAGGTTGAAATTGAAAGCGTCTTCGAGATTTTCGGGGC
GCGTGAGGAGACTAACGCCGACGCAGCGTCTTCTGTCTCGTCCGGTCCTCGAGCAATGTCACTACCTTCTGACGCCATGGGAGGGAGCCGCTTGACGACT
CAAGACCTTGTGTTGGAGCTTCGGGGCGTCATGGCGTCCAGTGAGACCCCCGTGAGGACTAGTGGCGGCTCACGGAAGTCCATGTTGAGATCTGCGTCCC
CTCCACTGCCTGCAAAGGCTCCCATCAGTCCTCCTCCTCCACCTCCGGCATCTCCGCCTCTTGCTTCTGGCAAGAAACTGGTCCCCTCGAATCACAAGGT
TGGGCCCTCAGTGAGCAAACCTACGACGTCGAAGGCCGGCGCTTCAAATGGCGGTCTGAACGACAGCCACGGGAGTACCCAGAAGAACCAACACCGACGA
ACACCAGGCCCGAATCGACCTTCTGTCACGCCTAGCGAGGGGTCCTACTTGCAGGGTCTGGGAACCACAGGCGGCACCAGATACGACGACGACTACGCTT
CGTCCTCTGACGAGGAGAGCTACGACGACTCATCGGACGACCTGTCACTGCTCAGCAGCGATGATTTCCGCGAGCCCCAGTTCAAGAAGTACCAGGGTCC
TGATGCGTTCTTTGTGGAGGAGGACCTGGGCGCTCTCCTGAAGAAGCGGAAAGGAACGTCGCCCTCCATTGACCCCGCGGCATCCCCAACTTCGCCGTTG
CCTCCTGCGCCTGCTGTCGGGAGGGACGAGCGCGACGAGCTCCGAGAGCTGATGGCGGGTCTTGTCCGTCCTCGCAGCTCGTCGCTGCCGTTCCAGTCGG
GCCAGATGGGTGGAGCTTCGTCGGGTGAGCCACTGCAGGACTACGGGAAGCCGTCGTGGAGCGATGACGCCCCCGATCGCATCCCAACGGCCCACCAAGT
GGAGGAAGCTGTGCGCGAGATCCGTGCCTGCCTCGCCAGCTGCCGCTGCGAGTGCCCGTCCGACACGGAGCGCGCGCGCAAACTGACTTCCATCTTCAAG
GTGCTCCGCTCGCTGCACCGCGAGGGCGTGCGCTCCAAGTTCCGCACGCTGCAGCACGACGACATTCGCTACTCGAAGATGCTCAAGGCCACCCCCAGCA
TTATCAAGCTGCTCAAGCTCGCTGGCTACGTGTCCCTGCAGCAGAAACTCACCATGCGGCGAGTGGACCAAGACTACCTCGCCCTGTTCCTGCGCGAG