Description :
From Genome Similarity Track
Location :
Scaffold_382:20801- 33774
Transcript NameFunction/comments
Phypl_g7674DEAD/DEAH box RNA helicase, putative
Phypl_g7675hypothetical protein PITG_02675
Phypl_g7676hypothetical protein
Phypl_g7677hypothetical protein PHYSODRAFT_323413
Phypl_g7678ATP-dependent protease hslV
Phypl_g7679cyclic AMP-dependent protein kinase-like protein regulatory subunit

Sequence
12973 bases(100 bases per row)
ATCTAGTCTGGCTGAATCGCGACTAGAGATTTCGATGTGGGGCCCATCCGAGGACCAGGAAGCACTGCAGGCTCAATACGACCTCGACTAAAtggatgct
gctgtctcTTCTCGCAGATCTTCTTGATTGTTCCTCCGCGTGAACGACGCCGTCCTCTCTTCGCAAAGTAATTGTCGTAGCACACACTGCCACGAATGAT
GGTAACCTCCGACTTGGATGCTGTGCTCAATCTCCAGATCAGACGCGGACACCACAGCGAGAGCGTCACGATTCGACTGAAGTAAAAGGGCATGACCCGA
ACAGCCAGCTCGTGATCCCAAATAACTCCCCGATACAGAATGGAGTCGTGCAGATCCTTGTCACCAACGAAGAAAACTCTACTGATGAGAGCTATGTGGC
CCAAAAGTACAAGTGCAACAACAGGAGCCGCCATGTATGGCCGGAAGTGTAACTTGTCTCTCATGGCAGGAGTTAGAGAATCGAGAGTGAGAGCCCACTG
GATCCATATCCACCACGTAAACAGTATCAGACACTGTGAGCGTTCCCAGTTGTACAGGATGCAAACAGACAAGGTGGCCGTGGTGGTCTGGAAGGCGTAA
AAGAAGAAATCGAAAGAGGTGACAAGAAGCTTAAACAAATCTCGCTGGTAGAGAGCTACAAAGGGCAGAACAAAAAGCAAAGAACACAACAGCCCACCCC
GCGCTTGTGTGAACAAGAGCCCGAGTTCAGCGTCACCGAAGCCATTGATAAGAACCGAAAACGAAAGGAGGAGGCCAACGATGCCAACACCATACACCAA
CACAAGGATGCTGCCAGAAATTCGCAGCTGGAATACGACGTGGTTTGAGTCGAACGTGTGCGGGAATTTCACGAACGTCATTTGCTGGACCAAGCTCGAC
GCACGACCCACATTTTCACTAGAGTCCGACGAAGCAACCACATCCTTTTGTGAAGTCACTCTCGAAGACCGATCTCTGCGAGCGTGAACGATTGCCGGCC
CTTCAATTTGCTCGAGTTTCAAGCCACATCGGTAGATTACGCACTCGACTATCGACGATCGCTGCCTTCCTCGAAGCGTTTGGCGCTTTCTGATGACAAT
CTTGGTGATTAAAAGCGTAAGTGTTATCATGCCGTTACCAATGATATCGACGCCGGAGAGACTGAAGTTCGTGTGCGTATTGCTGTGGCTAAGAACAGAA
AAGCTTGTGCAGCCATCCAACCGCCCCAACATGATCCACAGTAACATGAAAACTAGCGGGGGAATGCCAAGAATGGTGACCAGGATGAGAGGCCGAATTC
CACGCACTTGACCGTCAATAAACACGATGTTGTGAAAGCCAATCCAATCGATCATCATCCTACAAAACCGAAGGTCCCTGAAGTATGTCGAAATCAGCAC
AGCAGTAAGCGTGGTAgtgcaggagaagaaccaaAAGTCGAATGTCCTCATCACAAGACGCACAATGTCGTATCTCAGCGTGCTAGGACCTCCGAGGCCC
ATGGGGAGCCATAGCGCAAGACTGATCACCGACAGAATTTGACCCGTTAGTGTGTCGACTCCTGTCACGACAGTATTCAAAACCATCCCGAGCATATTCC
CCATTATAAGTCGGCGGTGATACTTGGTGAGAAATCGGTGGATAGCTGCATGAGCTCTCGCGGGGAGAAGCTCTCCTCTAAGAGACTTGGATAAATCGAT
AGTCGGAAGGGGTTTCGCAGGTACTAGGGCGTATATGGGCCCAAGTCTAGCACTTGCTTCCACCAGCATGATCTCCGCTTATTTTGGATTAGGCCACGCT
TCGATCGCAAGGCAGCAGACGGACAGTACTGAAGGCTCTCAACCATGAAGGCAGCCAAGGCAAATGAAGACAAACTTAAAAGTTTGGCTTGACGAAAGCT
ATATTTGATTGCCTATAGTTGCTGCGTCAAGCCTTTGGGACGGTGTAGTTTGTACGGCTAGAAACTCGATGTGTGGCGATGACTTACTATTTCAACAGGG
GAGGGGGCAACTATTCTATCGTGTTGATATTGTTTTTTCTTGGTGGAACGACGTAGCAGGCGACACCCTATTACGCCGAGAAAGAGCTGTAGCTAAAGTC
TTCACGTCAACGATTTGACTAATGTGCGAGCTTCGCCGTCTTCCTCTCGAGAAAATGTTGTCATAGCAGACTGAACCGCGAAGAATTGAGACGTCATCGT
TGGAGGCTGACGCAAGCCGTGAGATCAAGCGCGAGCACCAAAGCGAAAGTGTCAACGACCGACTGACGTAGAACGGTATTACACGAACGACTAAGTGTTG
GTTCCAGACGATTCCCTCGAAAATCCTCGAGTCTTGCAGCTCTGGGTCTTCGGCGAAGAAAATACGATATATTATTTCGAGATGGTCAGCCAGCAGAAGG
CACAACACAGGCGCGGCAAAGCGAACATGGAATTTAAGCATATCCCGCGTGGTCGGAGTCAATGCATCTAGCGTAAACGCCCACTGAGCCCAGAGCCACC
ACGATAGCACCATAAGACAGCGTGAAGCATTCCAGTTGTACAAGACGCAGACTCCGATATCTGCACACGTAACCTGAAACGAGTAGAACGCGAAGTCGAA
GGAGGTAAAAAGGAGCCTCAGCAACTGGCGCTGGTAGAACACGGCAAAGAGACCAGTGAACGCAGCCGTGCACAGTAGCGCGATGAATGGTAGCAGTTCT
TCCTGTGCTGCGAAATACTCCGATCCAAGAATAAGCGGCGCATGCGAGAGCATCAGCCCTGCCACCCCAACTGTATAAACGACGGTGAGAAGCCACGCCG
AGAAACACGCTCGATTCGCAATCCTCCAAGACAGAAGCGTGTTAGTTGCCTCAAATGTCTTCGGGAACTTGACAAACATCAAATTCTGGATCTCATCGGC
GTCACGTATCGACGTTTCTTTCGAGTGGCACCTCGAATCTTCACTGGGCCACGCCAGCAAGACGGAGGGTCCGTATACCGGCTCAAGTTTTAGCCTGCAT
CGGTAGATGGTACACTCTACAATTGCGGATGACCCTCTCCTCTTCACTCGAAGATTTTTACGCCTTCGGAAGACAATTTTGGCGACTAGGAAGCCTAGAG
ACACCAGCCCATTCCCGATTACATCCAGACCCGAGAGCTCAAAATGTCGATGATGATTCTCGTACTTGAGAATTGTAAAGGTCGAATCAACATCCACTTG
TCCAAGCACGATCCAGACAAGCACAACAGAAACAGAGAATATCGTAGCGAGCAGGATGTAAGTGAGACTTCGGAGGCCGAGCACGTGCGCATCGACAAAG
ACGACGTGGTGGTATCCGATCCAATCGATCAGCATCCGCACCGAGCGCAGATCTCCAAAGTACGTCGACATGGTGACTGTGATAATGGTCGTAATAGCGG
AGAAAAACCAGAAGTCAAAAGTTCGAGCCACGAGACGCACGATGTCGTATCTCAGTGTCGTCACACTGCCCAAGCCTAGCGGCATCCAGAAGAGAGCCGC
TAGTACCGCAACGATCTGGCCCACGCGTGCTTCGACCAGCGGAACTGACACATTCAAACAATACGAGACTGCAGCACAAACTAAAACTGCTCGATAGTGC
TTGTAGTACTTGCGACGGATGTACGTGTGAACTCGCGCTGGTAGTAGTCGACCTCGAAAAGACTTGGACAGGTCAACTGCAGGAAGAGGTTGGGCTGGTA
CCAGAGCGTAGATGAGGCCGCATGGGCTGCCACCATCCTTGGTTTAGAGTGACATGAGTCAGAAAGGACCCTTAAACTCCCACGACACGAGCAACATTAG
CGCTTTGTACTAAAGCTGACCCCATGCACGTACAATACCCGAATGTCAGCGATGACCATAAAAATACTTGGAGCTGAGTACACTATTGATAGCGTTAAAC
CCTCCGCAGCCTTATGTCCTGACTCCGTTCGTGCACTTCCGACGTTTGTGATCTCTCCACGACACCCAACTTGATCGAGGTTCGCTGACGGATTCAGGAT
TGAATTGAACATGCCCTCTGAGCTCCGTCATACATCCAGGAAAACCTTGATGCTGCACCACAGACCCGCGAGGTCAGCGACCTCGGATGCAGGCTCCGTG
CATGAAGGAGCGCAACAAAATCCGACTACCAGGGCACCCGCACGACTTCGACCATTCTGGAGACGAAAACGTACGGTGACCCCCGCAATGCTGCGTTCGT
TTCTTGTGGCTGAGCAGCAATCGGCAGCATCTGTGCACGTGGAGAATGACCCGAATGATAGCATCGTCTTCCTGAACAACCCGGCAGAATTTAATCTGCG
CTCCTATTTCTTCGCGAAGCAGAAGTCATCTACTGCAGCGGATAGACTCGAGAGATCAGCCATTAGTCAAAGCTCACTCAGCAGTTGCCGTAGTCACACG
CGTGGGTTCGAGTCGCCGGATACCTCATTTAAAGAGGACACGCCATGGGGGACAAAACCAGAAGCCGTGAACTCCACCGCAGATGCGACGGCTGGACAGC
AAACGACGAAgccccgacgacgactgcgtgCGAAAGAAGAGTTGTGCATCGTCTTACCTCGGTCAAAAACCCGTGGACGCACGAGATCGCAGAAATCCTG
GTTCTTAGGAACCGGATTTATCGGACGAGATCCGGCAGAAGGCACTCTGGTCGTCACAAATGACAAATCGATGGACGCTGTGCATGCCGAGATCTCGGTA
GCCGGTGACGACTATTTTGTAAGCGATGCTCAAAGCGCAACGGGTACTTTCCTCTGCTTGAGTACACGATATCGACATTATCCACAGCGAGATGGCTTTC
GTCTGCGCCGCGGAGATGTCTTTCGGATCGGCCCAGCTACTTCTATTCGCGTCCTTGACCTGCAGACTGCCATTAATCACACTGCGATTCAAAGCTGCAA
GTCTCGCTCCAGTTCAAGTTCCAGTCTTGCGGTGGCAGCTGAACAGCCTGCATCGAAAACCGAGACCTCTAACGCTCAACCCAAACTGGAGAGCACATCT
AGCAccggcagcagtggcagtggAACCTCGGGACCAGCGTTGAAACGAATGTCCACCGTGGAGGAACTCcgacttcttgctgcagatATTGAGGACGAAC
TCATGAACGACAATGGACGATGCCATACCGGAACTACGCCACGGAATCAAGCACCTGATAGCACCAATGGCAGCAAGGATAACCCCCAAACTAGCGCGCC
CGCACGATCGAAGCCCCAGCACACTGTCCACTTTTCAGATACACCTCCGATGATGTCGGACGGATCCGTTTTTCTCGGTAGTCGCTACCTGCGCCCGGAa
gtcaaggagctgcactACCACGCGCCATCCCAggttgaagacgccgaggacgaTATGATCAAACAGCTTGTTGGAAGTGAGCACGAGCCCCCGCTGACCG
AGTACTCCGCCACTTCTTCTAGTGCCCAAACCCGCCGACCTGCAGGCATTCGCCTTGTCATCTTCCAGCACGATCCTACCAACGCTAGCACCGAGCCTCA
AAAGCACCAGGATGCTCGAGAAGTGACACTCCCCGGTCAAGACGCTTACCTGATAGGGTCCTCGGCCCCTTGCGATGTGCGCATTTCTCCATCCGAGGGT
ATTGAAATCCGTGCCATGCACTCTCGAATTGTGTTTGACGGAACATCCTTCGTACTGCAGGACGTGTCTTTTGAACGTGACCCACGGCGACAAACACGCG
TCTTGCTCACTCAGAGACCCGTACACATCACTCGAGGAGATTGGTTGCTTCTTGGTAAATGCGCGCTGTACGTAACAACAGCGGCAAGGGCCTTCAGCTC
CGAGCGCCGTCCTGACATGAAGGAGGCAGCCATGCGCTTGGACGTCTTACGATTGTCAAAACGGAAACCTAGGACCAGAGCTTTGTTCGTCCCTGTAGGG
TTCCGCTTACACTCCAGGTCGGGGTCGGGAGCATCCAGCGGGAGCAGCGGTTGGggtggcagcagtggcggcCCCGTCACATTCGGCAAAGGCCGGGACT
GCGACGCACAAGTTTTCACGGCATCACTGGCTACTGAACAATTTagtgtccagctcgagcgtggcACTTGTTTGCTCACGCCGAAACCCACAGGACTCAA
TGGCGGCACATACTTTCTCATCGGGCGCGACGAAGGTGGACCACAGTTTCTCGACAACGCGGACGACAGTGATGATACAAAATGGAGCGAGATAGTCAAG
CACACGAGCAAACCTTTGCTGCTTTCAGAAGGATGCGTCTTCCGGTGCGGTGGATGCGAGGTGGAGGTCATCTGCGTTAAAAGTGCGACAGCGACCGGCG
TGAAAAGTTCTGCTGCGATCGAAGAGCAAGAACACATTCAGTTCTTGAGTGCCATGCCATGGCTGAAGCCGGTCGCCGCCGACATTAAGACTGTCGCAAA
CGTTGCGCGCTGTGGCCAGAGGCTGAAGCTCAACGCGAGAGATTTGATCTACGAGAAGGGTGATGCCGCAAATTTTGTCTTCATCGTGATCAGAGGAGAG
GTAGCACTCCACACCGTCACGACAAACGGCGGCACCGACGACAGCAATGATACCCAGGTTCTAATCGAGCAAGTAACAGCGGGGGGTTTCTTCGGAGAAG
TAAGCTTGCTCGACCCCTTCGAACATTGCGCTTCAACGGCGAATAGCGACGGCCTCGAGTATCCCGAAATCGCaagagcagccagcgcgtgcgAGCTGCT
AGCCCTTGCTAGAGACGATATCTGTGGGTATCTGGAGCTGTACATGAACATAATACGCGCTCACATACGGCACGATCGGTGTCGAGACAGGATCATCcgt
gctacatgtagttgtGTGCCTTGGCTGCGAGGAATTTCTCTCCAGGAAATGCGGATGCTGTCAGCTCAGGCCGAAACTGCTGTTTATCCCCCAGGATCAA
CCTTGTTCGAGGACGGGAAACTGTTTGTGCCCGCTGCCTTTGCCGATGGCAAAACGTTCCAACGTCGTGACGGGCTTCTGGTGCTTAGCCGTGGGAATGC
AAGGGTCGTGAGAAACAAGCACGAAAGACAGCATCGACGCAGCATGAAAATATACCATGCCGAATATTTTTACGATGCTCACCGAGACTTTGAGGTTGTC
CATGCTGTCAATGATGAGGCAGACGATGAGCCCGATGAGTGGTGGAGTTCCATGGAGCCAGTGATCGCCATGAGTTCGAGCGCCTCTCCATCAGTACTGA
GATTCTGTGACGTGTCTTTCCGCCTCGAAGCCTACTCCACCGTTGAGTGCTACTTCATACCCGCAGCTCATCTTGCACACTTGAACGTTGGTATGACAAC
CAAACCACCGCAAAACCCCATTCCTGGCTCCGAAGCACCCACAGTTGAGCAGATTCCACTGAAACGAAGCAACTCGCAGGTGGGGAGACGAATGCACCAT
TCCCAGGTAGTGACCAGCGCATTGCATAGTGGAGACGGTAACACCAGTGAGGACGATGACCATAACTCGATGGACGGGTCCGATGGCGAAGGTGAtacca
cagcagcacgacgttggAGGCGCAAAAAACGAAACAAGCACCTTCTCAAGCAGACAGTGCTGGGGACGCAAAATGACGCGCAAATACCAAATGCGTTAGT
GCTGTACGTACTAGCAGGAGCGCAGCGTGGAGATATCCACATAGTTCGTAATGTCGCATCCATAGGCGGCCTTCTAAGTGGAgccgccatcgagctgaAT
GACCGGTATGTTTCGCGCACGCATGCCATCATTGAATACCATGAAGGCAGGTACTGGCTCTACGATAACGGGAGCAAGTGGGGGACCTTTGTGCGCCTTG
AGGAGGACAACGCTGTCGACATCAACCCAGGCGATGTCTTTTTGGCTGGCGAGGTTGAATTTACTTGCCTCGCTTCGTATCCAGAGCGCAATAAGCCCAG
CATGTGCTGCATCATGTAAGATAGCCGTGAAATAGACTGTGAGAAAGAGCAATGAGCAATAAACTTTGAATAGACCACCACCAGAAATTCAGACGCTTCC
ACCTATTCGACATTCTTACGGGGCAACGACGGTGGCCCAACCAGTACGTGTGCCAGCACAGCCGCTTGAGCGAATTCCTGGCCTGATTGGATCTCAACGC
AGACTGGGCCACCCAACGCCTGAAGTCCACCAACAACAGGTAGAAACTCGACCCATACTGTCTTCATTGTCTTCGCTTCCATCACACCGATATTCTGGTC
ACAATCCACACATTGAACACAAGTGGTTTTGTTAACGACAAAAAACACTTTGTACCAGGTAATACTCCAACGTACCTGGTGTGATGCGGACGAACACACA
ATTCCACGCATCAGTTCCCTGCGGAACTGCAGTTGGAGCGCTAGGCTTCGAGTCGATTTGTTTGTCACAGATACAGCAGCCAAGAAGGGTTGTCCAACAA
CCACTTCCTTGGGCAGTTCATCAACAGCCACGGCGACTTCACTATGatgtccagctccagcgtgacCAGAAGCCCCAGGAACCTTCCGCATCACTGGTTG
GCTCTGCACTGATCCTGCTTCTCCCATCGACGATTTCCACCCCACATGCAGTCGACCAAGGTTTTGCGAGCCCTACACATATGCAACATTCCATCGACGG
ATAAGTATTCCATAGCGttggctacatgtagtagttCTCTAGATTACCTGtgtcgccagcagcgacgggtCTGATGCTGGGTCATACGAGACGCGGAATA
TGCGCTGAAGTTCCTCCTGTGGGTAAACAAGCGTTTGCGGTCCGCTGTTAAGTGACAACAAGTCTTCAATCGAagcttgatctccttctttCTTGCCGAC
AGCATGTATGTGCATCTCTTCCGAGGTAAATGGCGGAAGCGGCAAAAACTTGATACTGTCTACAAAAAGCGGCAATTTGGACACATTCCGAATCTGCGCC
TCCACGATTGCCTCTCCCTGTTGCTGTTGCGATGCCGTCGAACTCTGCTTGAAGGTAATCACTAGCGGGTTCTGCACTGCGAAACGGTAGAACTTCCGCA
GCGACTTGCTCTCGCCCGTGACTGGGTCCACGTAGGCCACGCCCACTCGAAGCACGTGGTTCCCCACTTGGTTCAGCGGGTAGTCCACCACCATATCCAG
ACTGGAGCCAGCAGGCAGCACTGCGACCGGATTGGGAGGTGGGAGTTTGCCCGTTCGGGCGTAGCggttgtcgcgcagctccactCGGTCGTTAGCACAC
TGGATATTGGCCGAGAGACCCACGTCTCGCAGCTCGCACGAGTACGGGTTGATGACGCTGATGTAGCTGCTGAAAgtgttgcccaggaagaTCTCTCTGT
GAAGGAATAAGGCACCGCAATGATGATTCCAAGTAAGAAAGTTGTGTCCAGACAGAGATCGACGATGCGGACGCACCCGAAGCTGTCGGGCAGGATGAGC
ATACTGGAGAGCGCGAACTCGTGCTGTGTGGCGGCAACCTCGGCCATGGACGTGGGCAGCATGGAGCCCCCGCTGACCCCTTGCACGTAGAGCTTGGGCT
TGTACAGCCGCATCACTGCGGGGGATTTTACAGTATCACAGCGTAAGATCATCGACATTACACGAGAGAGGACCGGAAACGAGAAAGTGAGCGACCGCGC
ACCTTTGAGCGTCGGCTGCACGGACGGGGGCGGCGGAGAGGGCGCTGGTGggccgcccccgccgcccGAGGAAGGCGGCCCGCTGCTCGcgaacgaggag
ctcatgaGGATGGATGCGATTTTGAGTCAAAGCATGCCATTGGCCAAAAACAACAACGAACCCTACTGTCATAATAACACAAAATAATCTAATCCTATTT
GTTAGGTTAGTCTATATTAAAGGTAATTCTTGATTAGAGGTCGCGTTCGCTCCCCTCGTTTAGAAAGCAACATGCTGGCCCGCTCGCTGTTCcgcgccgc
ctcgagcgcgcgcacgtcgccgtcgctggccgccgccgccgccaacttGGGCTCTGCGCAGGTCGCGCGCTTCTCTGACGCCCCCACGGTACAATTCGCC
TCGAAGCTCGGCGACAAATCCGTATTCTAACGTGGTAATTGGCGTTTTAGATGCACGGCACGACGATCCTGTGCGTCCGCAAGAACGGCAAAGTGGTGCG
TTGCACTAGAGATGCTAAAACGGAGGGGACGGAGTGCTAACTTGTGCTGTTATGTCGCGTAATTCGGAGCAGTGTCTGATCGGAGATGGCCAGGTATCGC
TGGGCAGCACCGTGGTCAAGCCcaacgccaagaaggtgcgACGCATCGGCGAGCACATCGTGGCGGGCTTCGCCGGCTCCACGGCCGACGCCTTCACGCT
CATGGAGCGcctggaggccaagctggacgagtaccCGGGCCAGCTCACCCGCTCGTGTGTGGAACTGGCCAAGGACTGGCGGACGGACAAGTACCTGCGT
CGTCTGGAGGCTATTCTCATTGTCTCGGACCTCAAGCAGTCGTACACGCTCACGGGCAATGgagacgtgctggagcccCACGACGGCATCATCGGCATCG
GCTCGGGAGGCACCTACGCTCTGGGTATGTGGAGATTTTGTTTTCTTCCTGAGGTCTTGCTGAAGCAAAGATGATTGACTTGATGATTTGTCGTGGTTGT
TTGAATACtctagctgctgctcgtgccctGATCGACCAGGATCTGAACGCCGAGACGATCGCTCGCAAGGCCATGAAAATTGCCGCCGATATCTGCATCT
ACACGAATGAGAACTTTGTTGTGGAAATGCTGGAGGAGGGCAAGGACGACGCGAACGTGGAAAAGAAGGAGTAAGCGGCGAATCTAATTGCATTGAGCTG
TCTGCAAAATTGTTGTAGAGATATTGCAAGTCTGCAGCAACGCTGAAGTCAATAAATGTGCAGTCGCTACCACTACTCAACCAATCTCATTCCTGCTTCG
TGTGGCTCGACAGTATAATTGAGCTGAGGTCAaggaagaaaaaaaaaacgcaaTCAAGTCCCATGTAGATAAAAAAAATATGATTACGATAATATAGTCG
GGCAGAGGAAGATAGGAGAACGCTAACAGTTACCACAGAGTCAACTGCATTAACGCCACCCCGTCCGTAAATGAGACGCGAGCTCCTCAACTTGGTGTGA
TTTGTCGATAACAGCTTTTTCATCGCATGGCACTGTAGGTGTCCGCTTGCAGCCCGCTGCTACTTGGTCCTTTCGCCCCTTGCCTCTCGAAAATCGCGAT
GGTGGTTTGAAGGCGTGTATAAATGTATTGGTGCGCTTGTGCGCTTTCCTGTTCCTGTAGCTGCTTAAATGTTGTTGGCGATGATCGAGTTGTACTTGTC
GATGTTGCGCTTCAGGATGTCTTCTAGCGGGCCCATAACCCGCTTGAACGTTTTACGGTCCAACGTTAGGCACTTGACCTTGCCATTAGCTGTCACGGTA
GCCTGGCGCGGTCGAGTCGTGAGTAGTGCGATTTCACCGAAGTATGCACCCGACGTGAGATCGCCCATTTCCACAGGCGGATCTGCGGGTGAGAGCTGCT
TCGTACACACTGCCGTGCCTTCCTCAATAATGTAAAACAGGTTACCGTCGTCACCCTGGGTAATGATGACTTCGCCATCACTAAACGTCTCTGTTTTGAG
AGCATCTGCCACTGTGAGACGCTCGTACTCGCTCAGCGACTCAAGCAGCGGGACGCGCTCAATAAAGCCCTTGTGTGCCTCGCGTTTCTTTAATGTCGTC
TCCATGATGATGAACTTGAACGTCTGTCGATCCAATGCCCATGCCTTGGAGTGCTGCACTGCCTTCACAGTCGCAGCACGCGGGGCGTTGTACATGAGTG
CCAACTCTCCAAACGACATAGCCTCTGTGCACTGCATCGATCAAAGTAATAGCAGTGAAGAAAACAGCGTAAGCACaacgaaaaaaaaaaaaaacagtaC
AAGCGATCACGTGCGACGCACCGTTTgtacgagctcgtcgtccttgtaGACCTCGCAGACGCCGCTCTCAAGGATGTAGAAGTtgtctccgtcgtctccc
TGCTTGATGATGATGTCACCAGGCTCGAATTCCTTGGGGAACATGGCGTCGAGCACAatctcgtgctgcttctcatccagcgacttgaacaGGATGTTTT
CGACCACCATGCGACTGATGCCCTCCCTCTCCTCTGTAGACTTGGGATGCACCACGCGCTCAAATTGCCGTGCGCTGCCGCGTCACATAcagaacaagaa
gaagtcaaGTTAGTATCAGACAGGGCGGCGAGCATAGATAGCACTAGCAACCCCCATGACTACCAACCTCAGCGGGTCGATGGTTTCAGCGGACACCGAA
GTGCGCCGTCCCTTGGCCATGATCTTGGGTGGCGGTGCGCTGGCGGCAATCTCGCCCACGGCGTCTCcgccctcgtcctcgtcctcgctctcaCTCTCGT
CCGAGTGGTCTGCAAGTGGGCACAGAATCCTCGTTAGATCTTTtccccctcctcctcctctctctctctctctgccAGTTTCAAAACTTAAAGCGTCGCG
TACACTGCGCATGGGGCGAGGCCGCCGGgttgtcgtccttgtcgccgGGCTTGCGGCGCGGCGTGGCCTCCTCCGGGTAGTTGGTCTGCAGGTACTGGAT
GATGTGCAGGATGGGGTTCTCGggcttggccagcagcagcgactcgacgagGTTGATGAAGAGCGTGTTGATGCCCTTCTTGTGCAGGTagtcctgcagc
tcctgctgcacgccctCGGCGTCCGTCATGGCCGTTGGTCTCCGCTGTCTGTCTGTCTTGGTAGTGAGCGAGGGTGGCGCTCTCTGGTTCGGCAAGCCCT
GAACTAAACTGAGCGCAGTGCGGCGCGGGCCTTCGCTCCAAAATGGAAGAAACTCCTGCTCGCGTGGAGGAAAAAACAGCAACAGACGCTGAACCCAAGA
CACGGCCTGAAAGATCGCTCGCTCTTGTGTAGTCGCACTCGCGACCGCTTTATTTAGCTCGTCCTGAATtaga