Description :
From Genome Similarity Track
Location :
Scaffold_707:208- 2145
Sequence
1937 bases(100 bases per row)
GATACAAGCTATTCGAAAAAGAAAGACACGATTATTGTTAAGCGTAACGTGTATATACAAGGTGCCTCGCATATCTTCAGCTGGAGCTGGATTTCGTGTC
GAATAGCTTTCTTTGTTGGCTTCCATAGCAGCTTAAAGTTCCGCTACGACATCAAAACGTGCCAATACGAAGTAAATAAGTAGGAGAGCAAAATTTAGTC
CTACCTCGATCGATCTCGTCTACATAGAGCATCAGATCGTTTTCGTCAATGAAATAGTCGACACCGCGCTTGTCCTTCTTGGTCTTCCCTGGTTTCAGAC
ACGCGAAGTCGACCGAGAGACCGGTTGGTCTCTTCGAGGTCCATCCTGCTTTCTTCATCTCGGACCAGCGAGCGCGGAACGCCATGTGCCATGTGTGCGC
GATTCTTGTTCGGCAAATGAAACGGTTTGAGCAGCGTCAGGCATTCGCCTGTCATTATTTATATGAGATGTGATACGCGAGTCTATCTCCTCTAATTTCT
AATACGGACGCCCTTTCTAGGCGACTCATCTATGCACTTCCAACGGGAAGCTTGGCAACATCACCTATCCCGCGCTGACTTGAATTTTGTAGGAGCTGCT
ACACAACACAAGTATAAAATTTCTTAACGTGTAAGGTCCGCGTTAAGTGACGTGTAAGGTCCGGCCGGGTGCTTCGAATCAAGGGGTTAAAGGATACAAA
ACTGTTATGACAGGGTATACGAAATCGCTGGATTATCACGCCCATTGGTTATCGCCGAATGGGCTCTGGATAAAGGCACGTGTTGGAGTGACCATCTGGA
TATTATGAAACGATACAGTTTTGACCACCTGCAACCACCCGATGACCATTTGTGCCAATCTGAGCCCATCCAGTGCCCACCAGCGACCATTTCATAGAAA
GCCAGCTTTTGCAATCATGTGATGATGGACCACGGGTATAAGTATAACCGAAAGTGAATTGGTCGAGTAGTTCGACGTCACAATACAGTAGTGTCGCCAG
TCTGTGGAGCGCTGACGGACGCGAGTTCTCGAGGCGTCAAGGGCTTCAGCTGTGCTGTACGCTGAAAATTTACGCTGCATTTCTCCCGTTGCTGCTGCCA
CTGCTACCGCTTCTACTCAATCGAGCTGGCGCTTGTGACTTTGGTTGCGCTGTATCTTTCATGTTGACACTCAGACGACAAGCACGCTTCAGCGCCATCG
AAAGAAACTTCGTCAGGGCACAACCGTTCACGTGGATGGAATGTATTACATGCACATCTTAAGGTACCTATACCAAAGACACCGCAGCTTCTGGCTGTTC
ACAACGCCTGGTGAGGTCACACCAGAAAACATCTCGGAGGCCAGAAGCACGTAAATGCCACAGTTATTGCTGTCTGCCTGGATGCCGAAATCCGCGTCAT
AGAATCCAACGTGATAGCGTCCGGCTCGGTCTGGGAGGAGCGCTTTCCGTTGTTCCGCTTTCGCTCGTACTCCCACCTTGTACGTAGACTGCATAGGTTC
GTAGCACTTCACTTCTCCCGTCGCAAGGTTAATCATAATGGCGCACCAATGACTGGAGCTGCAGCTGATTGGGATGAGTACACGCTCGGTGGAGGCGCCG
AAAAACGAGCCTATTAGTGTGTTCACGTCCATGTGTCATGTATTCATCGACACCGTGATCGCATGCGGGCTCACGACGATGACGTCTAGACTTGGACCGG
ACAGCTTGTTGAGCACGGTGCTCATTGTCACATCGCTTAGTCGGTACTTTGCGGCCAGATCAAGGACCTCCATCTGCAGTGCCCAGCAACATAGTTAGCT
ACCATCGCAGCCCAAATTAAAGATTGCGATGACTCACTTCACTCGAAAGCAGCCGGAGATCCCGAATCTTCATATGCATGGCTGCATCGCAGTCGATCGC
AAAGTATAAGACGGAAGCCCATACGTGACCATCTTGA