Description :
From Genome Similarity Track
Location :
Scaffold_1564:208- 1729
Sequence
1521 bases(100 bases per row)
GTATTAATCTTGGAACAAGAATGAACAAACAGTCTTGTGGAACTGATATGTAAGCAGTAATGTGGTTTCCACAAAACAAAATCCATATTTAAAATTACCC
TTATGGAGCCACCACAGCGACTCATGGCAAAGCCTTTCTGGATTGCCCTCATGCTTCTATTGCCCTTGGTTGGCACTGTGAGAGCGGAACTTTTCTGCCC
AATGGAAAAGCTGATAGAAATCGCGTCCTGCCCACACGCGACCACATATCTGTCTGATTCGGGTAGCGAAAGCTTTCCAGACATGTCCAAACTCTCCTTC
GATGAGATTAAGATATAGTGTGACAGTTCGGCTTGCACGGCATTTATAAAATAGATAGGAGCATCAGGACTCGGTGATTGCAAAATTCCAGGTATGAACA
CACTCTTACAGACCGACGGAATCGATGAATTTGAGACAAAATGCAGCGCAATTCGATCGATGGGATCATCAAGCGACACCACTTCCAACAACATCCGAGA
AGAAAGGAGCTCAAGTGCGACGAGCAGCGCTACGAGTATTGCCACGAGATTCTAAGAATCAAAAGGACTTGCGTAAGTGAATTGGCCTTGCCATTTACTT
GCACAAATACAGTGAAAATTACGCTGATATGGCTCGGCCATTAACTAATCTCATTAAAAAGGACACAGATTGGCACTGGGACAACACCCATGCTGACGCA
TTTATGGCAATGAAGGAGATTCTCCTCCGTGCTCCCATTTTGGCGTTGCCAAATCCTGAGTACCCTTTCAGTGTTGTCTGCAATGCATCCAACTTTTCCC
ATAGGAAGAGCTATGTTACAAACCGATTCTGCAGGCCACGAGCGAGTTATGGCATTGAATCTCGTCAGCTGAAAGCTGCTGAAAAGAACTATCCAGTTCA
TGACAAAGAGATACTTGCTATGAAGTATGCGCTCATCAAATTTGGAGTACATCTGCTTGGATCCAAGCCATTCGTCGTCGATACGGATCATGCGTCATTA
CGCACGGCGACACAGTCACCTCACCTCTCTCAGAAATTGGCTCGGTATCTTTCCTTCTTTGCGGAATATAACTTCGAGGTGAACTATAAGCCACGCAAAC
AAAATTTGTTGGCAGATGCTCTCTCTCACCAACCTGATTAGGAGCTTGCTCATGTCACGACTTTGTCGTCTCCTATTGAGGAGATCATTCGTGTGGACTA
CTTACGGGATCATTAATGTGTGGCATTGTTTCATGACCTTAGGAGTGAGGAATACAAGGACTCGGACAGTCAATTATCGGCACGCTTGCGGGTCGGCCTG
CATCGATATTCCATCGATAATGGCCTCTTGTGCTATCGCAAAGATGTAGTGGATACCGCTCGCATTGTCATACCTCACAATGAGGATTTAAAGTGCCGAA
TCCTCTTTGAGGCCCACAATACTGTCCTCAGTGGGCATTTGGGCCAGGAAAAGACTTAATGCTATGTGAGTCAACACTACTGGTGGCCCAAACTCTACAA
TGGGTGATCACATACGTGCGT