Description :
From Genome Similarity Track
Location :
Scaffold_2649:208- 1544
Transcript NameFunction/comments
Phypl_g15284putative polyprotein
Phypl_g15285hypothetical protein

Sequence
1336 bases(100 bases per row)
ACGAATACCACGACGCCCCCGTCGGTGGTCATCTCGGCCGCGCGAAGACGTTCGCTGTGCTATCTcgcgacttcttctggcCTCGCATGTACAAGTGGAT
TCGAAAGTGGGTTCGATCCTGCGAGACTTGTGAACGCGTCAAGCCCTCACTTTCGTCACAGGCTCCGCTCCATCCATTGCCGATTGCTACGGACGCGTGG
CGTTCTGTCAGCATGGAGTTCATCTTCGAGTTGCATCCGGACGACCAGAGCCGCACGGGTGTCCTGGTCCTCGTTGACCGCTTCAGCAAGATGGTTCATC
TTGCTCCAGTCGCCACTCAAGTCACCGCGGAAGACATGGCCAGACTGTTGCTCGATCTGATATTCCGGCACCACGGTCTGCCGGAATCCATCGTGTCCGA
CCGCGACCCGTGCTTCACGTCAGCCTTCTAGGATCGACTCTTCGAGCTGGCTGGTGCGCGCCTGCTGATGTCGACGGCGGCCCATCCGGAAACGGATGGA
CAAACAGAGCGCGTCAACCACGTGCTGAAATACGTCCTTCGCAGCTACACCACGTCGTTCTCCTCGTGGAGTTCCTTCTTGCCGCTTGCCGAATTCACCA
TCAACAATGCCGTCCACGCGGCAACAGGGTTGACGCCGTTCTTCGTGAACAACGGGCGGCACCCGCGCGTTCCGGCGATGCTCGCCCTGGAGTCGATGAT
AGATAGCACGGGCTCCACTTCTGGTGGGGGAGGANGCCGAGCGTATCGGCGCTAGAGTCGAGTGAAGCTGATACTGCATCGGGAGCCACATCGATACTGC
AACCGGAAGCTCCGACGGTACCGGTATTCCTCACCGGTACCCCCGCCGACACGTCGCTGCAAACGGCATCGCATCGAGGACCCGCTCGCAGAATGCGAGT
CCCACGCAGTCCCACAcgacttcttctcctgcttcgcCCGACGCGACTGGTGCCGTCGCGTCTCCCTTCGCCAACTTCGCTCCCAAGGAACCTGCTTCGC
CCATCAGCTCAGTTGCTGTGTCCGACTTCGTGCTCCATCGCCAAGCCGTCAAGCGCTTTGTACGTGACGCGCTGCAAGCAGCCGTGGATAAGCAGAAAGA
GAATGCGGACAAACGGGGTCGGAAGAATACCGCTGTCTTCCGACGAGGCGATCGCGTCCTGTTATCAACTACAGGGATTCAAGCATCAGCAGTGACGAAG
TTGGGCGCNCACTAGATATCCCGACCGCGATGCGCCTTCACCCGACGTTCTACGTCGGGCGCCTCAAGCCGTATCATCCGGCGAGCATCTCCGATCTCCG
TTCGCGTCCCCGCGAGCGGGCGCGTAATTCGAGACC