Description :
From Genome Similarity Track
Location :
Scaffold_1803:208- 1525
Transcript NameFunction/comments
Phyta_totarag13679hypothetical protein

Sequence
1317 bases(100 bases per row)
atgGGCGTCCCCGATCGNCAAGATCACGCCAACCAGACCGACGTATTCGAGGAGGGAGTGCCTGACGAAGGAAAGGAATCGTAGGTGCTAGGTCGTCGAT
ATTGACGACATCCACGTGACGGCAGATTCGTGGGATACGTTGTGTGGaaaggtggagaagctgctagACGCCTGTGATGAGTGGAACCTGTCGATCAGTG
TCGCCAAGAGCTTCAGGGGCCTACGCAAGGTTGACTATCTGGCCCATCAGGTGTCCGCGGACGGACTGGAAGCTCACCCGAAGGACCTACTGTCGCTGAC
CGGTCTGCCATTTCCGGCTACGCTGagatcgatgcagtcgttTTNAGATCGCTACAGCACCAatcttgcagcacttcgatccagatcgaagaccggtggt
ggtggtatATGCGAGCAAGTGGGCAATTGCGGCCGCGTTGATGCAAGAACATGGGGGCGTATATAAACCGGTGACGTTTACTAGCCGGACGCTCAAGCCT
AACGAGATCAATTACGAAATCGTCGATGAGGAAGTTCTCGCGCTGCCCAGGCTTTTGGATGCCTGTTATACGTAGCTAGGGACGAGATCGGTTAAGGTGC
TGACTCGGCCCTCCACGTTGGCATGGCTAGTGCACTTATCAGGATTGCAAGGGCGACTCGGTCGCTGGGCCGCGTTGCTGCCGAGCTGGACCCTGCAGAT
CGTCAAGTGCGACAAAGGTGAGGACGAGATCCTGGCCGCAATGGCCGCAACCATCACGCCACGTGAAGAGATCGACGCGATCTTGGTTTCGATAGCACCC
AGGAAACAGCCCCGCCAGGTAATTACCATGCCGCCACCTACAGTGGAAAAGTTGCTCGTGGTCAGCTTCGATGGATCAGCTCGAGCAAagcgaggtggag
gagcgTATGGCGCCACTGTGTGAAGCGTACCCGAATAGAAAGTGATCTCAGCGGCGGCGCAGTACAAGGACGATTTGGCAGTCAACGAAGCGGAATATCA
TGGCTTGCTCCTATGCTTCGATCTTCTGGTCGACCTGGACAGAGGACGGCTATTTATCGGCGGAGATTCGAATTTGATTATCCGACAGATGCGAGGCGAG
ATCGAGTGCAAGGCACCTGGGTTAAAATTACTACGCCAACAAGCTATGGAATGCTTGAGATCGTGTCAAGTCATGATTTCCTTCATATGAAGCGAGACTG
GAACCAAAGTGCAGATCGACTCGCCAGCGCCGCTCTTCAGCGTGAACAAGGCACGATAGTGACGTCGGATGAAGAGTTTATAGACTTAATGACGCTTAAC
CGTCTTGACGAGATGCT