Description :
From Genome Similarity Track
Location :
Scaffold_5:2079833- 2081113
Sequence
1280 bases(100 bases per row)
ACTCATCCCAACCGCCACTGAGGGTTCGTACCGTAGATGGTCCGCTGAATGCGAATCCGGCCAGTCCATTATTAATAATAAGGACAGCCTGGATTCAGTG
ACATATGGCCGTATCCAATACTCGTTGAAAGCTCGGAAGTGACGCCGTCGAGTCCCTTGCACCTTGGCATCTCCGTACATCACATGACCGAAGGTTCGTC
GCTTGAACATCTTGGGCGGTGTCACTTCTTTGTCGACAGTTGATAATCCGCAACTACGGAAAAATCACTACACCACAACAGTCCCTGTCGCAATGGAAGC
CACGGTACTGGTGCCTGTTGTGACACTTCTTCATTCTCCAATTCACCATCCAGTCATGGTATGTCCAAGCGTTTGAACCGAGCGGTGTCCGACGTGTTTC
AGCGTCTCAATCCTCGCCGACGTCGCGAGCGTGAACAGCTGGAGGTACGTCAGCTCATCCTTCTCTTGAACCATCGGCGCCTTGCTCATCACCACGCATT
ACTCGTTTTGTTTCTCAGGAGGGCAAGACCGAGGGTTCGAACGTCCCCCAGTCTGGTGCACTTCCTCCGACAGCAGCGTCATCAGCCGGTCCTCCGGCGC
TTCCTGCCCCGGACTCTTCATCCTCTGCGGTAGCTCCTGCTGCACTCCCTGTCGCCGCTGAATCCGCGGAGATGGATCCTTCTGCTCCTCCTGCGCAAGC
TGGTGGTCCACCACCACTCACCGAAAATTCGCTGCGCACCATGCTGGCTGAAAGTACGGAGGCATCGGTCGATCACATGATGACCTCGATAATTCCGTAC
TTGACTGCTATGGCTCGTCACCAAGTGCAGCTCAGCGTTGCGCCTCCTCTTTACGGCGATGTCCATGCTCAACGTCGCCTCGAGACTGCTGTTGGTTTCG
ATGATGTCCTCGCTGCATGTTCTACGACGTTCTCCAACATCTCGGCTACCTGTTGAGGGGTCCAGCGACGTTTCGTTTTCAGTGGTCGCTCCCCGGTCGG
CATTCATGTTTTCTTACTCTTAATCCACTTCCACAGCGTAATCATGTTCATGTTGTTCTTCAAATGCGGAAGTGAGTGTACAGTAGAGCGCTTTGCTTGT
GCATCGCCCTGTGGATATTTTACACGTGATCCAGTCACGCTAGTCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAA
TAGTCGTACAGCAGACCTCCACATGACAAGTTGGATGCTGGTTCCCAAGTTGGATCTTCATAGCCCACCCACTTGACTTT