Description :
From Genome Similarity Track
Location :
scaffold_478:20798- 22491
Transcript NameFunction/comments
g8683.t1hypothetical protein

Sequence
1693 bases(100 bases per row)
TTCCGCGAAGGTCGTCACGTGGCGAACACGTATGGCGGGCCCTGCGTTCTGGTGGGCTACGAGGATTTCACGGATGAGGACATCAGAGAACTGGAGCGTG
TGATTCCCAGCTTCACACCAAGCCAGGTGGTGTTACCACAGGCTGGAGGTCCGAGTGCTAGGGAATTGGACGCTCTGATGGCCTCCATTGAAGTCCACAA
AGAGGTTGCATCAATCCTGGCGCATGTCCCCCACCCTCGACTTGCTGAGCGCGTGTTAAAAACAGCAGGATATCTGAACTCATGGCGGCTGCTCATCGTC
GTCTCCGAGAACGCGTTGGCTCTCAGAGCGGCGTCGCTCTGATTGACGCAGCGGCGGCGCCCACTGAATGTGAGGAGCTCAAGCGTGAATGGGTGCTGAA
CTGTCAGTACCGGCGCCACGAGCTTCAGAGTGCGCAGCGGGAGGCCGGAGCGGTCGAGGACCCCATGACTTCAGAGATCCAGAATCTCACGTCACGTTAC
CAGGACCAAGTGGAAACCCTGAAAACGGAGAAGACGACTCTGAAGTCGCAGGTGTCGGATCTGCAAGCTCAAGTGACACTGTTGAAGTCGCGTCCTGAGG
TCAAGGCCAAGGATCCATGGGGATTTTCAGAGTTCCTGCAAGAGAACTCTAATATTTCTGGTAACTGGGACAGCCTTCAAGATCTTCTGATGTTCTACCA
AGAGGACGCATTGGTTCCTGATGATTGGACAACGGTCATCAACGTGACGGCTCTCGACCAGCGCAAAGGGCCCATATTGGACTTCAAGAAGCGCTTCGCC
GAGGTGAAGGCGAACGGGGCCGAGGAGGAGGCCGCGAAGGAGTCTCACAAACTGTATTTAACGTGTTCTGGTGGCGGCTTCTCAAACTCTGGTGACGAAG
ACTCTGATGCCGCACGTCCGACACCAGAGCCTGCTCCGACTCCCAGGTATTTGCAGTATACTGCCAAGTCTCCGCCAGCAAAATCACCAGGGAAGTCGTC
GTCTTTCAGACCAAATCGTCAAGATCTCAAGCGGCGCCCCTCTGTGCATCACCCAGGTCTAGACTCGGTGCGCTCAGCTGGCGCTAAGACTGCCGTGGCG
AAGAGCACCGTCCACACGATGCTTCCCGGGGATGTCGCCTGGAAAGAAGTTCGTCCAGGTCTCCGGCAGGTTCTGCTGTCTGGTATCGCTTACGACAAGG
TCATGGAGTGGCTGGGCTCCAACAAGGCAGCTCACAGCCTCTTCAGCAGCTCCGCCCTCGTACAGATGCTTGTGAGCATGACTTTCTGGCGTCAGCTGGA
TCACACTCCTTGGGCCAAGTACGTCCCAGAGGTCTATTACAAGATGGCCGATGAGGTGCTGGATCGCATGATTGCATCTGGGGAGCAGCCTGCAGTCTGG
GGACCTTTGGATGGCCACGTGAATTACCCTGAGAGTGGCGTGGTGTCTACGGCAGACAACCCCAAGTAAGACCCGGACTACAAGGACTCTGGTGTCGCCG
ACTCTGAGTCTGAAGACGACGAGGGTGACTCCGAAGAAGAAAAGTCTGATGACCATCCTCACGCGGGATCCAAGCGCTCTCGTGACGACGATGATGACGA
CTCTGACTCTGATGACTGACCCATAGTCCCTACCAAGATGTCCAAGAGAAGTCGTAGCTCGGTGGTCACCAGGTCAAGTCCAAAGACCAGTCC