Description :
From Genome Similarity Track
Location :
Scaffold_1300:2079- 4716
Sequence
2637 bases(100 bases per row)
GAGTTCCAAAGCGGCGATGGTGCCCCTGTACTCTGCTTCATTCACGGTACTAtCTTCGAAGAACTGTGTCCCAGCCGCCACCACGCTCCACTCAGGTGCC
TTCCAGAGGATAGCTCCACAGCTGCCGCCGCCCCTCTTCGGCTTAGCCGATCCATCAAAAGAGACGACCCAGGCCTCTTCATCGGCTGCGAGCTGGGGGA
TTGGCAGCTGGTGCCTCGTctGGGTGGTTGCCTTGTGCGGTCGAATCGCCTCCAACATCGCGTCTGTATGATCGGCTGGGCCGATTGtGGCCGCCAGCAG
CCCAGTAAGGCCGTCTTCTCCTTTCACCGCTCGCTTGATATCCATCGTCCACGGCGATAGCATGACCGCCCAGCGTTCTAGCCGCCCcTGCAGCCCCTTa
GACTTGAAGAGCCACGCGAGAGTgCTGTGTCGAGTGATCACCTTCAGCTTCCTCCCTGCCAGCAGATTCGACGCACCCGCGAGCGCCTGAAGTAGAGCCA
ACACCTCTTTTTCTGCGATAGCGAATTTCATCTCGTGCGGCTTCAACACTCGGCTGAAGAACCGAACAGGTGCGAGGGTAGCATcGTCCGGCTGGGCCAG
CGTGCAGGCGATTGACcAGTCGTTCGCATACAGTATCAAGATCGGCTCCTTGGCTTCGTCGTAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCCACGTGGATCCACCAAAAAGGATATCATCAATATATGACCGTCGGCCGATTGCCGGCTGCACTTCT
GAACCTTCCGGCTCGCTGTCCTTGAACACATCAGCTTCTTCCTCGAGCATGTGGCGTGGAAGGAGCTTGAGATAACCATAGAGTGCGTTATCTAGAAGAC
GCTGATAGATCTGAGGTGCATTCTTTAAGCCGAACGGCATTCGCAGCCACTCGAATTAGCCGAAGGGTGTGACGAAAGCGGAGATGGCTCTGGCTCGAGT
CGTCATCTTCACCACCCAGAAGCCGCTCGCCATAtCGTGGGAACACAGCCATCTGAGCGCACCCAGATTTTCCAATAGGTCTTGAACGACGGGCATCGGA
TACACCATCAGCCGGGTCAGTGAATCGACCACTCTGTAGTCGATACATAGCCGAATGTCAACGCCGTTCTTCTTGATAACGATGACAATAGGAGATGCCC
AAGGAGATGTTGACGGCTGGATAAATTCCGCCTGCAGCAGACCTTTCAACGGCTGATACAGCTGGTCTGAATACTGTGGTGGGGCCTTCCGGCACGtCTG
GGCAATCGGCTCGGCGACTCCGACgTCAATGTCGCAGACTACGCCTTTGGCGGCTAGGGGGCGAGCATTTCCTTTCCCCATGAGATATCGCCGCCTCTTC
CAGACGATTTCACGAACTCTTCCAATCTGTTCGGCTGAGATATCTTCTCCAGCCGCTACCTGGATGTCCTCTCGCTTGATgTCGGCTGCTGGATCCACCT
CTGGGATGACAGCCATCTGTCCTTCGAGCTCTTCTGCACGTAGGTCGCCTCCCTCGTGGGCATATACCGGCTCTGACAGTTTCTCTCCCTCCACGATCGC
CTCGGTAATGGACTTAGCAGTTACCAACGCGATAGCCGCCCTCGCCCATCTTCCCACGCCGGCTACAGGCGACTCATTGAGATCGGAGCCAGCTGATATA
GAGTCGGCTCGGCTTACCGAAATATCGTCCGGCTCGGGGCTTCTTCCAGAGCCGCCCTCCGCCTCGACTAAAATCACGGCCGCCTCGACTGCAGCTTCCT
CGTCACGTGGCCGGCTGAGAATCCCAGTCGGAGTAGG