Description :
From Genome Similarity Track
Location :
Scaffold_295:20789- 23964
Sequence
3175 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCCGGGCTGTAAGACGTATCATATACATCATGATGGCATTTTTTTCCTTTTCTCAGTG
TGGATGAAACGGCAAAAATATATTGAGAAAATAGCAATTCCCTAAGATAGGGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCAGAGT
TGTGTTCGCGTCACAGCGAGCGGACATTTATCTCTGGAGAATATCCCATTGCGAGCGCAGGAGCTTATTATCTAGGATACGCCGTCCTAGGGCTTGCTTC
AGTTGCTCGCTATGGCACATCACACTTTCCTTAGTCAATTGTGTGGTAAAGCGGGTCGAAGAAATCGGAGGCGATCGTTGGGTGGAGTGATCTCAAACCG
CGACAGTTATTGAGAAGGATCGATTGGCTGTTAAGCTGCGCAATACCAAGACCGAATATCGCAATATCAAGATCGAATACCACGATACCGAGAGTGAATA
TCGCAATACCGCGATCAAATATCACAGCAACGGGATCGAATATCAAGTTGCCGAGATCGAGGCAAGATACCAAGATCGGGAACACATAAGGAAGTCGGGA
AGATGACCGACAAATCGGCAGGGATCACGGTCCTAGAGAGTGATCGACGATCAGGAGATTGAAGATTGATCAGAAGATTATCGAAAAAGGAGATCGACGA
CCACTCAAGGAGATCGATGATCTATCATCGGAAGTGGACCACATGTGCGAAGGAACGATCAACGGAATGTAGAGGACACGTGGCAGCATATCCTGGCATA
CAGAAAGACACAATGGTAGTTTTAGGTTTTGGTTGGTTAACATTAAACATAATTCTATTTGCTTCTACGTACACGTGTCGACTTCTCTTCCGGGCTGGAT
ATTTGGCCTTCCGACGTCAAGAGAGGCTCACATACTGAAATCAAGTGATATCCCCAGATAATTGACTGGGGATCAACAATTCTCACCCCCCACCTGCGAT
CGGAAGCAGCAAGAACGTAAAGGACAAGGCGCAGATCGCGAGACGTCTCAAGTGGTCAGAAGGCTCGCGTATCAAGCATCCACATAGTGGACATCTCGTT
GAGATCTCGGTGGCTTACATCAAGTAACCTACCAGTATACCCGTGATCGTGTGAAGGTTTCCGCGCGATCACAAACCCCATTCCCAACACGGCAAAGTTT
TCTCTCGACACGAGTCTACCGAGAAGAGTGCAGCCCGCCCTTATGACGGGTACACAAGGTGAGGAAGGAAATACAAGGCACGGAAACGGAGTACCCTCTC
CAATAGTCGGTCGTCTGGGCACCAGTGGAGAGTCGGGATCGCCTCATAAAATGAGCGATCGCCACTCCACCACAATTGCGTCAAGAATGCCGCGCATACT
CTGTTCACTTCGACTTAATTCGCGCTCCTTACAAGTTTCAAGTATAAAAGAATGTATGATGACCCTGAGTATTCAACAAACATTCTTTTGTACTTGAAAA
TTGTATGCTCGGTGTGGTCGTATACTTTTGACCGGGTGCCAAAAGCGGTTTTTTGTATGTGAGCTATGCCACCAACTCAAAAGATGTGGACGTTAACACA
TGAGAGGTATGTAATAAAGCTTTTCGCATAACATACTCAAATAAACAGCGCCCAACTCGTACTAGTTATAGAATTATGAGTAAAAATAAATATTGGCCAT
ATATTTATGGCTCGGACTGTAGTATACTCGAGTTAACGTGACAAACATAAAACCCCACATATTATTCATTTCTCCTTTCTAAATTTACAGGTCTTGCTCA
ATTCCGTCCAGTAGTGGCATCCCCTGAGGGTATCCGTAAGGGGTTATGCCGCGGGAGTGCTGCGTTCACAATAAGTGATTGCGAAAGCAGGCGACAAGAT
GAAAGGTGTGTCACGCGTGATCACGTCGTCCGCCGCGGCTGTAAACATCGACAGTCGGAGCTGATGTTGTTGATATTGATGTTATTTTTTGTTACTATGT
TATTGTTGTCAGAACTATATTGTTATTGTTGTTTCAATTGCTGCTGCAGTTGTTCTACTGCTGTTGTTGTATTCGCTGTTCCTTGAAGTTGTTTATGATG
TTCTGCTGACTTTGTTACTGCTGCTTGTGTTACGGGTATCGCTGCTGCTGCTGTTGTTGTTGTTATTGTTGCGTTTTGTAAATGATGCACTGTTGCTCAT
ATTACTACTGCTGCTGTAGGCTAGGATACTGCTTCTGCTGTTTTTGTTGTTGTTTTAGTTGTGAGACCAGTATTCCTTACTACTCATTTGCTGTAGCCAC
TTTAGCACATTTACCCATTTCAATAGACTCTCAAGAATCTATCCTATCTGTTTGTCTCCTATTTTATAAATTTGAAGTCTTTCGGACTTCTTCGACTACA
TGTGTATTGCAAGAAGGAAAATGTGCGATGATGCCTCCTAATGTATCGAAGTTGTTTGTCGTTTCGTTGTACGACAACGTTGATTATATATGTATCGTCC
GGATATTGTGGTTTGATATCGTGAATATGTTTTCTGCCATGTATCCGTGTCCATCACGACCTCTAGCCACTCTAACATCGGTGTTAATGCGACCGCGAGC
TGACGTTCATGGAGTCGAGCGGAAACGATTGTTTGCACTGCCTCGTTCGCAACGTGATCCGCTATCGCTCAAACTGGCGAACGAAAATGTGGGGGCTGAT
TACTGATCCCTTATTATTGGTGAGGGATTAATGACTGTGAGCAAGGTGAATACCGAACTTTCAATACCTACTTTATGTCTGTTTCTGTGTGTGTAAAATA
CGCTAAGTGTAAGATACATATCGTACTAAGTCAATTTAGTCTGTCGGCTCCTGTGTGCGTGAATAACGCCAGGTG