Description :
From Genome Similarity Track
Location :
Scaffold_62:207866- 211775
Transcript NameFunction/comments
Phyin_T30-4PITG_18429Putative uncharacterized protein

Sequence
3909 bases(100 bases per row)
TAATTCATCTGGTCTGAGGAATTATAAGTTTTTTTAAGATTGTTTCAAAGTCTTGTCCACAATGCATCTGAAATTATGCCAGCGTCAAAAATCCAATTTG
CCAGCGTTGCATCAAAGATGTTCGCTCCGATCTATCAACAAATTATTTAATAATCGTAAAATTAAAAAGAGCATTCCAGCAATTCATCGTATCTGAAGAA
ATGTAAATATTTGTATCTGTGTCGGAGTATTAACCATCGAGAGATTCAAATCAAACTAACGAAATATTCAAATCGAGCCTAAACAAAAAAAACAAAGTAC
TCCATGACACAGTCGGTTGTAAAGACGTATCGCCATTGAAACCAATCATACAATCAAAATTTCCATCGAGAAGCGAGCAGAAGGGAGTTTCAAATTTGAA
GACCCACTGACAACGAGCTAAAAGCGAATCAGCACGGCCCAATTAAAAATAGTGATATGCGTCTGCTGGACATTACTCAATAACTAAAGTAATGCTACGA
TAAATCGTATGAGTTCTGTCAACAAATAACCAGAAATCAACTTAGCAATTCGGTCTTCACGCACCATGGAGTTGCACACAACGAACAAACGAAATGCCGT
AAATCCAAGATAGATCACACTCCTCAATTGCTACATCAAAGATCTCGCCATCATACACGATCTTTATCCCATTTAGAACTTAAATAACAAAACAACGCGT
CAGTCGAAGCGAACTATAGCTTGCACATATATAAACGCCTTCATCGAGTGGTGTTTTGCACAAACTCGACTGTGCATGTTTTCCGTGCACTCCTCCAAAA
CGATTTTTATCCAAACTATGCGTGCTAATCTGCTTGAGGCTCTTTGCATTTGCAAACTTTATGTAGCATCTCAGTTCACCATAAGTCACACCAGTTGACG
AAAGCGGTTTGCGTCTTGCTTTACATTCTTCCATAAATTGACCCACTTTCAACGTCGAATGCCATCCTGCAATACCAATCATTTCTGCAGCAATGCCAAC
AGCATAGAAAGCACATGATCCGTCTGGTGAAGCACCAATGGGATGAACGTGATCGTTTCTCTTGCAAAATAAATAAAAGTTATCGATGTTTGATATATTC
CACGCGTCCACTACATCGCACGCCTGATTAAATCCATCCTCGCGCAAAGCATCCCCAGGTTCCCAGGTGTCATCCCAACGAAACCCCGACAATTTATCGC
ACCATTGTACCCGATAGAAAAAACCAGAATATTCCTTTAGTCGATCTATGATCGCAAAAACGAGTCCAGACTTCGAAGTAGTTCGTACTTGCTCTTGTAA
GACGGTGCAAATAGGCTGTTGAGATACCTCAAAGCCATTCTTACTACATGTAGTACGATGCTTGAATTCCGTCGCACGTGAGCGTTGTAGCGAATTCACC
GTTGACACAGTTTTAGTTATCACGTCACAGACTGTTTGCACCTTCTTGTTGACGTGGCTAGCCCGCTGCCCTTTTCGCGTTCCCTTCGTCCCTTTGCGGC
ACGCATCGGTCGAGCCAGGGAAACGGCCGATGCAGTAAATCAATCAAGTGGTCGCTCGCTACCTGGGTGCTGTTTTGTGAAAATGGGAAATGATAAGAAA
ACCTTAACTCGATGCATTAGTTAAGTTTAATGGCTATGTCTCTAGACTACAGACTTATATTGCTCTGTTTATGACTGTATGTTACGAATCTACCAAATGT
ATAGCATGTCCTAATTTCTGTAAAGGGGGAACCTTTCGACCTTTTGTACTTTAGACAGTCTTTTGAGGTGTTTATACGCGTCTTTATGCTCAGACGTATT
AACACTCACTGCCACCACTGGGTAGCGAGGCGGGGTAAACATGAGTAGTCCAAGTCGACACAAATTGCAATATTAATAATATAAAGCCAAATGTATTAAG
TCAACTCGGGGTTTCCCAGGCAAAATTCACGACTGACCAAACTTACCTCGCCCACAATGTCACCCGTACCGTAGTTCTACTCAGTCGAAGCGCACGTCAG
TACGTCCTTGGGTACACTGATGTCGACATCCCTCCTTTCCTTTTACTGTCCTTCGCATACGTAGCGGTATCCCTGTAGTCTGTGTCGTCCGTCCCAAGGA
CCTCGCACATCGCCGTGACGACAGGCAGTACCTCAGCCATAGCGGCACCTCAGACGACGTACTCAACAGGTAGCGTAGCTCCCTCTCCATACTACACGTA
GATGCGACGAGGTCAGGCCCCAATTCGGACAACAGAATCCGACAATGTCAGAGCTGATTCGAGCGACCCGACGGCCGCTCATCCTCTTGCCGTGCGACTT
TAAGTGGCTGGTCGCAGGTCACTCCAGAGGGGGAACAGGAACCGTGCTCAAGAAGGTTGCCACCGCTCTCACTCGGGACATCCTCCCCGACTGAATATCG
ACGCCCTCGTCGAGCTCGTCCAGCAAAGCCTTCCTTCTCCGAATATCTCATCTTAGCTCGCAAAGCCTGTCGCTCAGCATGTATCCCGCTCAGCGTGCGT
ACTTGCTGTCGCGTAGTCTCCACGGACCTCTATCCGCTTCCCAGAATGCTTCGCTAAGACGGTCAGCTTGCTCTCGTTCCTGTTCCTCCATGTCGCGGAT
ACAACCGAGCAGTCCTGGGCCACAGCAAGCGGCGAACGTCCTTCCGACATATACTCATACCAACGCCACACATGGCTAACCACGCCTAGCACCAGGACGC
ACCCGTCGAATAGTACAGTCCCACAGTTGACAACGACCCCACCAAACTTCACGACGCCCTCATTACTCGCAAACTTGTAATTCATCGTCACCGTTAAGAC
CACTACCCCAAGCCACCCTAGACAAGCACCTTTGACGATCTCGTACAGGAGCAGTACACCGTATAAAGTAGCGTAGACGACCAGTGTCACCACAGTTCAC
CAGACACGCACAACGAACCACGCACGAGCCCACGTTCATTGGAGCTCAACACCTGAACCGCACCAATACTTCACTGACGTCCTCCACGCCAACGTCACCG
CCTCAGGTAAGAACACGCACCAGTACGCATGCAAGGCGTCCAACAACTTGTAGAGTAGACGCCCTAGACCGCTAAGTGTATTTTTCCTCGCAGCGAGCAC
TACCATAGGAGTAGCCAGTACTGCTTCATAGGTCTTCCACCATTTCGTCCCCCAGAGCTGGTCTTGTGCGGCATGACTGCGCACATAGCTTCGATAGCGC
GTAATACAAAGTCTTAACATCTTAGCCCACTTATATACGAAGTAACCGCCCGAAGAGAAATGTCAAAGCACCAAACTTCTGAGAGGTTCGGTGACGGTCC
AAGTCAAGATACCACTCGCCACAGCGAACAACACCCACGCATGACTGAGGGCCAGTCCCACTCCAAAACTACACGTCGACACGACAGCGTCTCGACTCCA
CGCCATACCATCCTCTCGCGTAATCCATCGACAATCTCGACAATCGAGGAATGAATCCATCACACCCACGGTCCAACCGTTCTCCATCGTCACTAACCGT
CACTTTAATTCACTTGGCTGTGCACCAGCCAAGAGACCGTCCCTTGCTCAAGTCACATCACATCACCATCAAAACGGTGGCTTCTCGTCGTTGACCACCA
TGTCCGCCACTATTACTGCAGCTCCCTGTCGTGTCACAGGAGGCAGACCAATTAAAATGCATTCCGCAAGTAGCACACGTAGCCATGACCAAGTCGTCGA
AGAAGTCCGGGATGACCCCAACGGTCAAAGACCAACTCCGCTCTCGCCTCGACGACGAAGACAGGGCGGACGACGCCACCCCTCTACACTTCATGATTGA
GTTCTGGAGCCGCCTCCGAGCCGAGGCAGCCAACAGCCACTCCGTCGGGCTCGACGCCCTTGACCGACTGGTCCTCCGGCTCCTTGCCGACGACACTTCG
CAGACCCCG